ID: 1159299469

View in Genome Browser
Species Human (GRCh38)
Location 18:66544050-66544072
Sequence CTTCAAATACATAATATGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159299465_1159299469 11 Left 1159299465 18:66544016-66544038 CCTACAAATGATCCCTGTGGGGT 0: 1
1: 0
2: 1
3: 10
4: 95
Right 1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 279
1159299461_1159299469 16 Left 1159299461 18:66544011-66544033 CCACGCCTACAAATGATCCCTGT 0: 1
1: 0
2: 1
3: 4
4: 73
Right 1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 279
1159299466_1159299469 -1 Left 1159299466 18:66544028-66544050 CCCTGTGGGGTTTCTTCAAAAAC 0: 1
1: 0
2: 0
3: 23
4: 355
Right 1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 279
1159299467_1159299469 -2 Left 1159299467 18:66544029-66544051 CCTGTGGGGTTTCTTCAAAAACT 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159299469 Original CRISPR CTTCAAATACATAATATGGA AGG Exonic
902995534 1:20222096-20222118 CTTCACATACAAAAGAAGGAAGG + Intergenic
904553218 1:31338904-31338926 CTTTAAATACATCATTTAGATGG - Intronic
906252011 1:44318024-44318046 ATGCACATACATAATTTGGAGGG - Intronic
906592859 1:47044383-47044405 CATCAAAGACATAAAATGGAGGG - Intronic
906932156 1:50180623-50180645 CTTCCAATGCATAGTGTGGATGG + Intronic
907499449 1:54867590-54867612 CATCTAATACATCAAATGGATGG + Intronic
909286497 1:73826848-73826870 CTTAAAACAAATAATAGGGAGGG + Intergenic
909495717 1:76275747-76275769 TTTAAAATACATAATACAGAAGG - Intronic
910487781 1:87734341-87734363 ATTCAAATATATAATAGGTACGG + Intergenic
912016028 1:105036880-105036902 CTTAAAAAACATAATATTCATGG - Intergenic
913552989 1:119935218-119935240 CATGAAACACAGAATATGGAAGG - Intronic
918269896 1:182887993-182888015 ATTCAAAGACAGAATATGGGAGG - Intergenic
918823608 1:189292617-189292639 CTTGATATACATTATATGGACGG - Intergenic
918912273 1:190590430-190590452 CTTACAATAAATAAAATGGAAGG + Intergenic
919648944 1:200126162-200126184 CTTTAAAATCATAATTTGGAAGG + Intronic
921256125 1:213341115-213341137 CTTCAAAGACAAACTATGGCCGG - Intergenic
921341894 1:214142320-214142342 TTTCAAATATATAATAATGACGG - Intergenic
924015517 1:239716924-239716946 CTTCAAATATGCCATATGGATGG - Intronic
1063763242 10:9106258-9106280 CTTCAATTACATTATATGAATGG + Intergenic
1065472210 10:26094086-26094108 ATTGAAATACTTAATATGAAAGG - Intronic
1066542438 10:36462028-36462050 TTTCAAATATTTAATAAGGAAGG - Intergenic
1068457635 10:57278992-57279014 CTTCAAATATATAAAACTGAAGG + Intergenic
1068711623 10:60141276-60141298 TTTCAACTATTTAATATGGAGGG + Intronic
1071084268 10:81849980-81850002 CTAGAAATACATAGTATCGATGG - Intergenic
1072075063 10:91962874-91962896 CTTCATGTACATAATATATAGGG + Intronic
1072318538 10:94226597-94226619 ATTAAAATACATAATATCAAAGG - Intronic
1074012307 10:109494863-109494885 CAGCGAATAGATAATATGGATGG + Intergenic
1074554360 10:114474688-114474710 TTTCAAGAACATAATTTGGATGG + Intronic
1075309110 10:121396944-121396966 TTTCAAAGACACAGTATGGAAGG + Intergenic
1075420633 10:122297927-122297949 CTTCAAATAGATATTCTGGGGGG - Intronic
1076057542 10:127387913-127387935 CATCAAAAAAATCATATGGAGGG + Intronic
1077863330 11:6202233-6202255 CTTGAAACACATCATATGGTAGG - Intergenic
1078033168 11:7774216-7774238 CCCCAGATACACAATATGGAAGG - Intergenic
1079649060 11:22903767-22903789 CTTCAAATACTTAATTTTCATGG + Intergenic
1080139014 11:28892032-28892054 CTTCAAGTTTATAGTATGGATGG - Intergenic
1082238525 11:49849920-49849942 CTTCAAATACAAAATTAGCAGGG + Intergenic
1082958734 11:58899208-58899230 CTTCAAGTTCATAAAATGAATGG + Intronic
1082965412 11:58962091-58962113 CTTCAAGTTCATAAAATGAATGG + Intronic
1082974257 11:59056928-59056950 CTTCAACTTCATAAAATGAATGG + Intergenic
1082978667 11:59100723-59100745 CTTCAACTTCATAAAATGAATGG + Intergenic
1087459440 11:98426259-98426281 CTTCCAATCCACAATATAGAAGG + Intergenic
1087543610 11:99553571-99553593 TTTAAAATACATAATACTGAAGG - Intronic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1089911656 11:122106657-122106679 CTTCTAATACATATCATTGAAGG + Intergenic
1091537356 12:1424171-1424193 CTTCTAATAACTAATATTGAAGG + Intronic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092390202 12:8070716-8070738 TTTCTAATAGATAATAAGGAAGG - Intergenic
1092630871 12:10375116-10375138 TTACAAATAGATAATAAGGAAGG + Intronic
1092832728 12:12460940-12460962 TTCCAAATACCTTATATGGATGG - Intronic
1093062470 12:14621500-14621522 GTTCAAATAAATAATCTGAATGG + Intronic
1094304268 12:29000229-29000251 CATCAAATGCTTAATATGCAGGG - Intergenic
1097130621 12:56808479-56808501 CTTCAAAAGTATAAAATGGAAGG - Intergenic
1097993695 12:65864027-65864049 CTGCACATACATAATATTCATGG - Intronic
1101250541 12:102930069-102930091 TTTCAAATACATTATCTGTAAGG + Intronic
1101271126 12:103146130-103146152 TTTTAATTACATAATATGTATGG - Intergenic
1104089851 12:125507252-125507274 CTTCATAAACATATCATGGATGG - Intronic
1104435097 12:128749362-128749384 CTGCAAATACATCATAAAGACGG + Intergenic
1106322841 13:28658676-28658698 TTTAAAAAACATAATATTGAAGG - Intergenic
1106801229 13:33258261-33258283 CTCCAATCACATAATATGGGTGG - Intronic
1107914349 13:45134012-45134034 CTTGAAATACAGATTATGAAGGG + Intronic
1108354945 13:49621655-49621677 CTCCAAATTCATAATAGGGTTGG - Intergenic
1108900207 13:55393624-55393646 GTTCATATACATAATATATAAGG + Intergenic
1109916594 13:68995249-68995271 CTTCAAATTCTTAAGATGGAAGG - Intergenic
1110009378 13:70312794-70312816 CTGATTATACATAATATGGAAGG + Intergenic
1110156157 13:72319563-72319585 CTGTAAATACATGATATGGTTGG + Intergenic
1110309113 13:74026490-74026512 CTTCTATTACAAAATAAGGAAGG + Intronic
1110625593 13:77652181-77652203 CTTCTAACACATCATATTGAGGG - Intergenic
1110843775 13:80171161-80171183 CTGCAGATATATAATATGGCAGG + Intergenic
1111105052 13:83634298-83634320 TTTCTTATACATAATATGGAAGG - Intergenic
1111549620 13:89789880-89789902 TTACAAATTCATAATATGGAAGG - Intergenic
1111651788 13:91100170-91100192 TTTCAAATACATCATTTTGAAGG - Intergenic
1113201463 13:107870747-107870769 TTGCAAATACATTATATTGAGGG + Intergenic
1114230442 14:20776844-20776866 CTTCAAAAGGAAAATATGGAAGG - Intergenic
1115443716 14:33465105-33465127 CTACAAATACATAATTTGTTTGG - Intronic
1115454337 14:33584277-33584299 CTTCAAATGCATAAAATGTTAGG - Intronic
1115600585 14:34952031-34952053 CTCCACATACAGAATATTGAAGG + Intergenic
1115938540 14:38582910-38582932 CTTCATCTACCTAACATGGACGG - Intergenic
1116693702 14:48145154-48145176 CATCAAATAGATAATAAGAAAGG + Intergenic
1117529799 14:56649026-56649048 CTTCAAATCCAGAGAATGGAGGG - Exonic
1117846379 14:59915778-59915800 CTTCAAATAAAAAAAATTGAAGG - Intergenic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1121075359 14:91063609-91063631 CTTCATATGTGTAATATGGAGGG + Intronic
1121428321 14:93869281-93869303 CTTGAAATAAGCAATATGGAAGG + Intergenic
1123959241 15:25378093-25378115 CTTCATATACATGATTTGAATGG + Intronic
1125084262 15:35712281-35712303 TTTCTAATACATAAAATGGAAGG - Intergenic
1126775608 15:52098005-52098027 CATCAAATAGATAATAGGAAAGG - Intergenic
1126846355 15:52764303-52764325 CCCCAAATTCATAATATTGATGG - Intronic
1127738803 15:61876125-61876147 CTTCTAATCTATAAAATGGAAGG + Intronic
1134432477 16:14223542-14223564 CTTCAATTACATAATTTGTTTGG - Intronic
1135537975 16:23309058-23309080 CAGCAAAGACATAATCTGGAGGG + Intronic
1137759092 16:50926201-50926223 CTTCAAATTCATAATGAGTATGG - Intergenic
1138827883 16:60342614-60342636 TTTCAAATACAGAATATGAGTGG - Intergenic
1138960691 16:62025300-62025322 CATCAAATTCATAATAATGATGG + Intronic
1139339244 16:66257201-66257223 CATGAAATACATAATATTGCAGG - Intergenic
1139598532 16:67971911-67971933 CTAAAAATACAAAATTTGGATGG + Intergenic
1139763878 16:69210532-69210554 CTCTAAAAACATAATATGGCCGG - Intronic
1140565699 16:76038897-76038919 TTTCAATTACATAAAATGAAAGG + Intergenic
1141286154 16:82674105-82674127 CTTGAAATTCTTGATATGGATGG + Intronic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1144483343 17:15645345-15645367 CTTCGAATACAGAACATGAATGG - Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1144915344 17:18719681-18719703 CTTCGAATACAGAACATGAATGG + Intronic
1145683740 17:26631946-26631968 CTTCAAATCTAAAATATTGAAGG - Intergenic
1145932618 17:28696874-28696896 CTTGAAATTGATATTATGGAAGG - Exonic
1146168061 17:30607248-30607270 TTTCAAATAAGGAATATGGAAGG - Intergenic
1147957497 17:44144435-44144457 CTTAAAATACAAAATTTGGTCGG - Intronic
1149543804 17:57488373-57488395 ATTTAAATACATAATATAGTAGG - Intronic
1153968856 18:10206385-10206407 ATTCAGATACATAATATGCTTGG + Intergenic
1154243023 18:12669561-12669583 CTACATATATATAATATAGAGGG + Intronic
1154969072 18:21389025-21389047 CTTCCACTACATACTGTGGAAGG + Intronic
1155109749 18:22702470-22702492 AATTAAAGACATAATATGGAAGG - Intergenic
1155919809 18:31592295-31592317 CCCCAAATACATTTTATGGAGGG - Intronic
1157109780 18:44809773-44809795 CTTCTCATATATAATTTGGATGG - Intronic
1157234671 18:45953254-45953276 CTTCATATTCATAAAATAGAAGG - Intronic
1158781655 18:60659743-60659765 CTACAAAATTATAATATGGAAGG - Intergenic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1159616522 18:70586418-70586440 CATCAAAAACAAAATGTGGAGGG + Intergenic
1160080774 18:75725268-75725290 ATTCAAACTCAAAATATGGAGGG - Intergenic
1160311975 18:77802041-77802063 TTTCAAGTACATAATATGTGTGG + Intergenic
1162878825 19:13641913-13641935 TTTCAAATACATAAAATGTGGGG - Intergenic
1167614944 19:50527584-50527606 CTTCAAAGACATGATATGAACGG + Intronic
925292858 2:2759608-2759630 CATCATATAGATAATATAGATGG + Intergenic
926494709 2:13571717-13571739 CTTCAAATAAATACTGTGGTTGG - Intergenic
928521534 2:32093933-32093955 CCAAAAATAAATAATATGGATGG + Intronic
929714278 2:44294573-44294595 CATCAATAACATAGTATGGAGGG - Intronic
929905560 2:46043049-46043071 CTTCAAATGTTTAATTTGGATGG - Intronic
930178713 2:48328381-48328403 CTTAAAGTACAGTATATGGAAGG - Intronic
930530766 2:52585645-52585667 CTCAAAATACATATTTTGGAGGG - Intergenic
930784189 2:55254811-55254833 CTTCATATACATAATCTGATTGG + Exonic
931118768 2:59193424-59193446 GGTCAAACACATAATATGGCAGG - Intergenic
931216930 2:60253959-60253981 CTATACATACATAATATGTAAGG + Intergenic
932160972 2:69459216-69459238 CTTCTAGTTCATAATAGGGAAGG + Intronic
932452720 2:71824831-71824853 CTTAAAATACATAGTAGAGAAGG - Intergenic
934895192 2:98112526-98112548 CATTATATACATCATATGGAAGG - Intronic
936669640 2:114642211-114642233 CTTAATATAGATAATATAGATGG + Intronic
937191219 2:120101035-120101057 TTTCAAATAAATAATAAGTAAGG - Intronic
937642141 2:124225470-124225492 CTTCAATCACATAAGAGGGAGGG - Intronic
938506878 2:131894308-131894330 CTTCAAAGACATAGAAAGGAGGG - Intergenic
939437604 2:142199016-142199038 CCTCAAAGACAAAATATGGAGGG - Intergenic
939445343 2:142303046-142303068 GTTTAAATACATAAAATGTATGG - Intergenic
941598842 2:167513627-167513649 AGTAAAATACATAGTATGGATGG + Intergenic
941736574 2:168983473-168983495 CTTTAAAGAGATAGTATGGATGG - Intronic
942332869 2:174846816-174846838 CTTGAAATATATAATATTAAAGG - Intronic
944653232 2:201853100-201853122 GTGCAAATACATAAGATGGTAGG + Intronic
945732492 2:213555933-213555955 CATCAAAAACATAAAATGGGGGG + Intronic
946594551 2:221291934-221291956 CTTCCCATACATAATGAGGATGG - Intergenic
946945856 2:224821611-224821633 CTTCAAATTAGTAATAAGGAGGG + Intronic
946968966 2:225070639-225070661 CTTCAAAATCATAGTATAGAAGG - Intergenic
1169524423 20:6407941-6407963 CTTCAAAGAAAACATATGGATGG + Intergenic
1175427265 20:58876320-58876342 ATTCAAATACACATTATGGGAGG - Intronic
1176786757 21:13265977-13265999 CTTCAAAGACATAGGAAGGAGGG + Intergenic
1177467719 21:21510488-21510510 CTTGAAATACAAAACATGAATGG - Intronic
1177508227 21:22046391-22046413 CTTCTAGTACATAAGATGGTGGG + Intergenic
1177603436 21:23346018-23346040 CATCAAAAACATAAAATGGGAGG + Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1181292599 22:21808515-21808537 ATTCAAATTCATAAAATTGAAGG - Intronic
1182887205 22:33785329-33785351 TTTCTAATTCATAAAATGGATGG - Intronic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
952463952 3:33560647-33560669 CTTTAAATATACAATATGAATGG + Intronic
952580091 3:34823296-34823318 CTTTAAATAAATAATGTTGAGGG + Intergenic
955559866 3:60177200-60177222 ATTAAAATAAATAATAAGGAGGG + Intronic
955848484 3:63194087-63194109 CTATAAATTCATAATATGGCAGG + Intergenic
956490571 3:69767299-69767321 CTTTAAAGACAAAAGATGGAGGG + Intronic
957809858 3:85206936-85206958 CCTCAAATAAATAATATTTAAGG + Intronic
961856050 3:129872594-129872616 ATTCAAAAACAGGATATGGAGGG - Intronic
961914620 3:130360373-130360395 CTTCAAATTCATATTATGAGGGG + Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964949550 3:162272661-162272683 CTGCAAATAAATGATATGGAAGG - Intergenic
969676538 4:8617464-8617486 TTTTAAATACTTTATATGGAGGG - Intronic
970010910 4:11458122-11458144 CTTCAAATACAGATTTTGGGAGG + Intergenic
970331428 4:14988812-14988834 ATTCAAATACATAAGTTGAAAGG + Intergenic
970403670 4:15741920-15741942 CTCCAGATGCATAATATGGTTGG + Intergenic
970519659 4:16869813-16869835 CCTCAAATACTTAAGATGGAAGG - Intronic
971298077 4:25417807-25417829 CATCAAATACATGATATATAAGG + Intronic
972951915 4:44336425-44336447 CTTTAAATAAATAATATTTAGGG + Intronic
973078217 4:45957351-45957373 CTTCAAGGACAAGATATGGAAGG + Intergenic
973744219 4:53947440-53947462 ATACAAATACATTAGATGGATGG + Intronic
974834480 4:67231040-67231062 CTTAAAATAAATAATATACAGGG - Intergenic
975915016 4:79314351-79314373 CTTCATAAAGATAATATGAAGGG - Intronic
976531206 4:86154240-86154262 CTTTAAGCACAGAATATGGATGG - Intronic
976586804 4:86807510-86807532 TTTAAAATGCATGATATGGATGG + Intronic
976951082 4:90831593-90831615 GTTCAATTACATCAGATGGATGG - Intronic
977612619 4:99051689-99051711 CTTCATAAACATAATATATAAGG - Intronic
978304408 4:107309130-107309152 ATTCAAATATAAAATATTGAGGG - Intergenic
978515580 4:109565200-109565222 CTGTAAATACATAACATGCATGG + Intronic
979172122 4:117613227-117613249 CATCAAAAACATAAAATGTAGGG + Intergenic
980342908 4:131573973-131573995 CTTCAGGTAGCTAATATGGAGGG + Intergenic
982940933 4:161553351-161553373 CTTCTATTACCTAAAATGGAAGG + Intronic
984301265 4:177921340-177921362 CATCAAAAACATAAAATGGGGGG - Intronic
984838273 4:184042480-184042502 CTCCAAATACTTCATATGAATGG + Intergenic
985172356 4:187165196-187165218 GTCCAAATAAATAATATCGAAGG + Intergenic
986122989 5:4859510-4859532 CCTCAATTACATAATTTGTAAGG - Intergenic
987020047 5:13860853-13860875 CTTCAAGTCCATATTATGTAGGG - Intronic
988731383 5:33976404-33976426 ATTCAAATAACTAACATGGAAGG + Intronic
988886190 5:35560525-35560547 CACCAAAAACATAAAATGGAAGG + Intergenic
990931753 5:61099448-61099470 ATTTAAATACATAATATTAAGGG - Intronic
991447314 5:66714194-66714216 TTTCAAACACCTAATATGCAAGG + Intronic
994252760 5:97556147-97556169 TTGCAAATCCATAATATGGTAGG - Intergenic
994509032 5:100680065-100680087 CTTCAAATAAGAAATATGAATGG - Intergenic
995101677 5:108316765-108316787 CTTAAAATAAATAATATATATGG + Intronic
996391267 5:122964754-122964776 CTTCTTCAACATAATATGGAGGG - Intronic
996696457 5:126402164-126402186 CTACAGATACATAAAAAGGAAGG - Intronic
997963484 5:138339182-138339204 CTTCAGATACACAAAATGGAAGG + Intronic
1000145999 5:158453948-158453970 TTTCAAATTCATTATATGGGTGG + Intergenic
1001367359 5:171156239-171156261 CTTAAAATAAATTATATAGAAGG - Intronic
1005606469 6:27483336-27483358 CTTGAAAAACACAATATGGCCGG + Intergenic
1006933672 6:37702774-37702796 CTTCACATCTATAAAATGGAGGG - Intergenic
1008120371 6:47608853-47608875 CATCAAATGTATATTATGGATGG - Intronic
1009973407 6:70648410-70648432 GTTCAACTACATAATTTGCAGGG - Intergenic
1011016537 6:82762499-82762521 CTTATAATTCATAATTTGGATGG - Intergenic
1011527906 6:88286070-88286092 CATCAAAAACATAAAATGGGAGG - Intergenic
1011721293 6:90158996-90159018 CTTCAAATACTTAATTTCCATGG + Intronic
1012436596 6:99221307-99221329 CTTCTAAAACATAATTTTGATGG + Intergenic
1012769437 6:103410916-103410938 CATCAAATACATAATAAGAAAGG - Intergenic
1013359121 6:109377459-109377481 ATTAAAATACAGAAAATGGATGG + Intronic
1013770569 6:113623497-113623519 CATTAAATACATAATAATGATGG + Intergenic
1014505127 6:122246399-122246421 CTTCAAAAAATTAAAATGGATGG + Intergenic
1015275008 6:131375280-131375302 CTCCAGATTAATAATATGGATGG - Intergenic
1015948624 6:138528686-138528708 GTTTAAATATTTAATATGGATGG + Intronic
1016008838 6:139117417-139117439 CTGCAAATATTTATTATGGATGG - Intergenic
1019176731 6:170163070-170163092 CTGCATATACAAAATATTGATGG - Intergenic
1020479845 7:8645346-8645368 CTCCAAATATATTATATGGAAGG + Intronic
1020855059 7:13409770-13409792 AGTCAGATACATAATATTGATGG + Intergenic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1021909778 7:25373211-25373233 TTTCAAATACATAATTTGCTAGG + Intergenic
1022563693 7:31375378-31375400 GTTCAAATACGCAATTTGGAAGG - Intergenic
1023103413 7:36741182-36741204 CTTAAATTATATGATATGGATGG + Intergenic
1023766858 7:43519895-43519917 ATTCAGATAAAAAATATGGAAGG + Intronic
1023964775 7:44957512-44957534 CTTCAAAGACAATATATGAATGG + Intergenic
1024308234 7:47946010-47946032 TTTCAAATAAAAAAAATGGAAGG + Intronic
1024683405 7:51717979-51718001 CTTGAGAGTCATAATATGGAAGG - Intergenic
1024828808 7:53423645-53423667 CTTGAAATACATAATACAAATGG + Intergenic
1027554525 7:79647436-79647458 CTTAAAATTCAGAATCTGGATGG - Intergenic
1028678310 7:93494221-93494243 TATCAAATACATGACATGGATGG - Intronic
1028983340 7:96991311-96991333 CCTGAAATACATAACATGGGAGG + Intergenic
1030066505 7:105663518-105663540 CTTTAAATACATAAATTAGATGG + Intronic
1030383881 7:108845376-108845398 AGTAAAATACATAAAATGGAAGG + Intergenic
1030678295 7:112407775-112407797 CTTCCAATACATAGTAAGGTTGG - Intergenic
1030697892 7:112605902-112605924 TTTAAAATACAAAAGATGGATGG - Intergenic
1031040535 7:116834240-116834262 GCTCAAAAACATAATATTGAAGG + Intronic
1031529120 7:122854885-122854907 CTTCAAAATCATAATATAAAAGG + Intronic
1031781911 7:125978813-125978835 CTTAAAATACATAATATTTTAGG + Intergenic
1032595616 7:133236617-133236639 CAGAAAATACATAATATGGCTGG - Intergenic
1033844927 7:145420140-145420162 CATAAAATACATAATTTAGATGG + Intergenic
1033875025 7:145805172-145805194 GTTCATATATATAATATAGATGG - Intergenic
1035748972 8:1982101-1982123 CATCAAAAACATAAAATGGGTGG + Intronic
1036198943 8:6750011-6750033 CTTCAACTACTGAATATGCATGG - Intronic
1036925950 8:12906091-12906113 CTTCAAATAAATAATAAAAAAGG + Intergenic
1037496975 8:19449971-19449993 CTTAAAATCTAGAATATGGAAGG + Intronic
1038096876 8:24323016-24323038 CTGAAAATACATAATATGGGTGG + Intronic
1038602085 8:28954841-28954863 TTTCAAAGACATAAAATGAAAGG - Intronic
1039159584 8:34602541-34602563 TTTCAAATACATACAGTGGATGG - Intergenic
1039366797 8:36936586-36936608 CTTGAATTAGATAATTTGGAAGG - Intergenic
1039988293 8:42466380-42466402 CTTTAAATGCATAATCTGGCCGG - Intronic
1042264690 8:66895989-66896011 CTTCAAATACATATTTTTTATGG + Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1043092408 8:75922573-75922595 CTTCAAAAACATAATACATAGGG - Intergenic
1043101672 8:76055037-76055059 CTGCAAAGAGATAATGTGGAAGG - Intergenic
1043697476 8:83238337-83238359 CTTGAAATACATCATTTAGAAGG + Intergenic
1044124488 8:88440318-88440340 CTTCAAATATTTGATATAGAAGG + Intergenic
1044242719 8:89905197-89905219 TTTCAAAAACAAAAAATGGAAGG + Intronic
1045020357 8:98037996-98038018 CTAAAAATAAATAATATGGTCGG - Intronic
1045207923 8:100062397-100062419 CTTTAAATCCATAATAAGGTGGG - Intronic
1045889804 8:107141997-107142019 TTTCAAATACATAATATTTAGGG + Intergenic
1048280238 8:133100347-133100369 AGACAAATACATAATATGGCAGG - Intronic
1048411295 8:134176410-134176432 ATTAAAATCCATAATATGTAAGG - Intergenic
1048777235 8:137960660-137960682 AAGCAAATACATAATATAGAAGG + Intergenic
1048949175 8:139479431-139479453 ATTCAAATACAAAATAATGAAGG + Intergenic
1050346818 9:4697139-4697161 CTTCACATACAAGGTATGGATGG - Exonic
1050466772 9:5934660-5934682 ATTAAAAAACATAATATGGCCGG - Intronic
1050667903 9:7962207-7962229 CTTCAAGTACAAAAACTGGATGG - Intergenic
1050693283 9:8252360-8252382 CTACAAATATATAATAGGGATGG - Intergenic
1050763316 9:9100739-9100761 TTTCCAATACATAATTTTGAAGG - Intronic
1050847942 9:10247062-10247084 CTTCACATGCATAAAATGTAAGG + Intronic
1052376189 9:27720227-27720249 TTTCAAATACCTAAAAAGGAGGG - Intergenic
1054976366 9:71150594-71150616 CTTCATATAAATAATTTGAAAGG - Intronic
1056733704 9:89186304-89186326 TTAGAAATACAGAATATGGAGGG - Intergenic
1056973006 9:91224240-91224262 CTCCAAAGACAATATATGGATGG - Intronic
1058061743 9:100504454-100504476 GTTAAAATACATCATATGGGAGG + Intronic
1058494569 9:105542377-105542399 CTTGAAATAAATTATATGAATGG - Intronic
1060330787 9:122668049-122668071 CATCCAAAACATAAAATGGAAGG + Intergenic
1060806383 9:126579994-126580016 CTTAAAATACAAAAAATGGCTGG + Intergenic
1185510112 X:657785-657807 ATTCAAACACATAATTTGCATGG - Intronic
1187608462 X:20913459-20913481 CTTCAATTCCAAAATATGTATGG + Intergenic
1187691472 X:21872690-21872712 CTTAAAATACATACTATGGCTGG + Intronic
1188279565 X:28248137-28248159 TTTCAAATACTGAATATGCACGG - Intergenic
1190307060 X:49090223-49090245 CTAGAAATACATAATATAGCCGG - Intronic
1192121462 X:68460245-68460267 CTTCAATAACAAAAAATGGAGGG + Intergenic
1195395202 X:104402956-104402978 CTTCAAAAAAATAATATTGGAGG - Intergenic
1195995081 X:110723629-110723651 CTTCAAACCTATAATAAGGAAGG + Intronic
1196267238 X:113664826-113664848 GTACAAATCCATAAGATGGAAGG + Intergenic
1197239875 X:124112366-124112388 CTTCAAAAACATAAAATGGGGGG - Intronic
1198506447 X:137306064-137306086 CATCAGATACTTAACATGGAGGG - Intergenic
1199505881 X:148561004-148561026 CTTCAAATACATAAAAAATATGG - Intronic
1199522779 X:148755178-148755200 GGCTAAATACATAATATGGAAGG - Intronic
1201773636 Y:17642231-17642253 CTTAAAATACAAAATTAGGAGGG - Intergenic
1201827920 Y:18263754-18263776 CTTAAAATACAAAATTAGGAGGG + Intergenic
1202106637 Y:21376269-21376291 CCTGAAATCCAGAATATGGAGGG - Intergenic