ID: 1159306618

View in Genome Browser
Species Human (GRCh38)
Location 18:66651747-66651769
Sequence AGTTTAAATAGACAAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159306618_1159306619 -10 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306619 18:66651760-66651782 TATTTAAACTTAAAATCAGTAGG No data
1159306618_1159306622 21 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306622 18:66651791-66651813 CAGCTGAGGAAATGACTAATGGG No data
1159306618_1159306621 20 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306621 18:66651790-66651812 ACAGCTGAGGAAATGACTAATGG No data
1159306618_1159306623 22 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306623 18:66651792-66651814 AGCTGAGGAAATGACTAATGGGG No data
1159306618_1159306620 7 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306620 18:66651777-66651799 AGTAGGTAGAAGCACAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159306618 Original CRISPR AGTTTAAATAGACAAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr