ID: 1159306619

View in Genome Browser
Species Human (GRCh38)
Location 18:66651760-66651782
Sequence TATTTAAACTTAAAATCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159306618_1159306619 -10 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306619 18:66651760-66651782 TATTTAAACTTAAAATCAGTAGG No data
1159306617_1159306619 17 Left 1159306617 18:66651720-66651742 CCTTTTTTGATCACTAAGATCAT No data
Right 1159306619 18:66651760-66651782 TATTTAAACTTAAAATCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159306619 Original CRISPR TATTTAAACTTAAAATCAGT AGG Intergenic
No off target data available for this crispr