ID: 1159306622

View in Genome Browser
Species Human (GRCh38)
Location 18:66651791-66651813
Sequence CAGCTGAGGAAATGACTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159306618_1159306622 21 Left 1159306618 18:66651747-66651769 CCAGCTTTTTGTCTATTTAAACT No data
Right 1159306622 18:66651791-66651813 CAGCTGAGGAAATGACTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159306622 Original CRISPR CAGCTGAGGAAATGACTAAT GGG Intergenic
No off target data available for this crispr