ID: 1159307693

View in Genome Browser
Species Human (GRCh38)
Location 18:66666525-66666547
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159307693_1159307695 -10 Left 1159307693 18:66666525-66666547 CCCTCAGATTTCTACAGGCAAAT No data
Right 1159307695 18:66666538-66666560 ACAGGCAAATCATTCTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159307693 Original CRISPR ATTTGCCTGTAGAAATCTGA GGG (reversed) Intergenic
No off target data available for this crispr