ID: 1159308125

View in Genome Browser
Species Human (GRCh38)
Location 18:66672339-66672361
Sequence CTGCTTCTCCAGCTTGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159308118_1159308125 27 Left 1159308118 18:66672289-66672311 CCTTGGTTCTGAGGCCTTCAGAC 0: 12
1: 102
2: 213
3: 410
4: 912
Right 1159308125 18:66672339-66672361 CTGCTTCTCCAGCTTGCACATGG No data
1159308120_1159308125 13 Left 1159308120 18:66672303-66672325 CCTTCAGACTTGGACTGAGCTGT No data
Right 1159308125 18:66672339-66672361 CTGCTTCTCCAGCTTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159308125 Original CRISPR CTGCTTCTCCAGCTTGCACA TGG Intergenic
No off target data available for this crispr