ID: 1159319428

View in Genome Browser
Species Human (GRCh38)
Location 18:66827911-66827933
Sequence AATTCTACTCCCCTTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159319428_1159319429 5 Left 1159319428 18:66827911-66827933 CCATTTTCAAGGGGAGTAGAATT No data
Right 1159319429 18:66827939-66827961 CTAATAGTCTAAGTGAAGAGTGG No data
1159319428_1159319430 19 Left 1159319428 18:66827911-66827933 CCATTTTCAAGGGGAGTAGAATT No data
Right 1159319430 18:66827953-66827975 GAAGAGTGGCAAAAAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159319428 Original CRISPR AATTCTACTCCCCTTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr