ID: 1159321550

View in Genome Browser
Species Human (GRCh38)
Location 18:66857215-66857237
Sequence GAGGCAGAACTGAATCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159321545_1159321550 -4 Left 1159321545 18:66857196-66857218 CCCAGCTACTCAAAAGGCTGAGG 0: 267
1: 9140
2: 119134
3: 221358
4: 238231
Right 1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG No data
1159321547_1159321550 -5 Left 1159321547 18:66857197-66857219 CCAGCTACTCAAAAGGCTGAGGC 0: 193
1: 7203
2: 104328
3: 208994
4: 230990
Right 1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG No data
1159321543_1159321550 4 Left 1159321543 18:66857188-66857210 CCTGTAGTCCCAGCTACTCAAAA 0: 137
1: 4062
2: 57009
3: 181961
4: 231393
Right 1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159321550 Original CRISPR GAGGCAGAACTGAATCTGGG AGG Intergenic
No off target data available for this crispr