ID: 1159325792

View in Genome Browser
Species Human (GRCh38)
Location 18:66915400-66915422
Sequence TAGTTGGGGAGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159325782_1159325792 -6 Left 1159325782 18:66915383-66915405 CCAGAGCCTGGGAAGGGTAGTTG 0: 4
1: 74
2: 579
3: 1271
4: 1821
Right 1159325792 18:66915400-66915422 TAGTTGGGGAGGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159325792 Original CRISPR TAGTTGGGGAGGAGGGTGGA GGG Intergenic
No off target data available for this crispr