ID: 1159327575

View in Genome Browser
Species Human (GRCh38)
Location 18:66943151-66943173
Sequence CAGGGTCATCAGCATGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159327575_1159327580 26 Left 1159327575 18:66943151-66943173 CCATCTGCATGCTGATGACCCTG No data
Right 1159327580 18:66943200-66943222 GTAGCTACTGCCCTTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159327575 Original CRISPR CAGGGTCATCAGCATGCAGA TGG (reversed) Intergenic
No off target data available for this crispr