ID: 1159334938

View in Genome Browser
Species Human (GRCh38)
Location 18:67049926-67049948
Sequence ATTTATATGCAGACTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159334938_1159334941 -9 Left 1159334938 18:67049926-67049948 CCCTCTTCAGTCTGCATATAAAT No data
Right 1159334941 18:67049940-67049962 CATATAAATCTCCCTTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159334938 Original CRISPR ATTTATATGCAGACTGAAGA GGG (reversed) Intergenic
No off target data available for this crispr