ID: 1159337072

View in Genome Browser
Species Human (GRCh38)
Location 18:67082029-67082051
Sequence GGGTGAGCCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159337072_1159337076 3 Left 1159337072 18:67082029-67082051 CCTCAATTTGCATTGGCTCACCC No data
Right 1159337076 18:67082055-67082077 AATTTGCATGCAATTGAATGTGG No data
1159337072_1159337077 4 Left 1159337072 18:67082029-67082051 CCTCAATTTGCATTGGCTCACCC No data
Right 1159337077 18:67082056-67082078 ATTTGCATGCAATTGAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159337072 Original CRISPR GGGTGAGCCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr