ID: 1159349809

View in Genome Browser
Species Human (GRCh38)
Location 18:67258089-67258111
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159349802_1159349809 20 Left 1159349802 18:67258046-67258068 CCATGTTCTATGTAGGCAGGTTG No data
Right 1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159349809 Original CRISPR CCTGTTTTGCAGGCTGGGGA GGG Intergenic
No off target data available for this crispr