ID: 1159363748

View in Genome Browser
Species Human (GRCh38)
Location 18:67438657-67438679
Sequence CTGTGTGAGGACATCTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159363748_1159363754 28 Left 1159363748 18:67438657-67438679 CCAAGTTAGATGTCCTCACACAG No data
Right 1159363754 18:67438708-67438730 CAGATCTTCCAAATGGATTTGGG No data
1159363748_1159363755 29 Left 1159363748 18:67438657-67438679 CCAAGTTAGATGTCCTCACACAG No data
Right 1159363755 18:67438709-67438731 AGATCTTCCAAATGGATTTGGGG No data
1159363748_1159363753 27 Left 1159363748 18:67438657-67438679 CCAAGTTAGATGTCCTCACACAG No data
Right 1159363753 18:67438707-67438729 ACAGATCTTCCAAATGGATTTGG No data
1159363748_1159363752 21 Left 1159363748 18:67438657-67438679 CCAAGTTAGATGTCCTCACACAG No data
Right 1159363752 18:67438701-67438723 CAGATCACAGATCTTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159363748 Original CRISPR CTGTGTGAGGACATCTAACT TGG (reversed) Intergenic
No off target data available for this crispr