ID: 1159367286

View in Genome Browser
Species Human (GRCh38)
Location 18:67484492-67484514
Sequence AGGCGAATCCTGCCTCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159367286_1159367289 0 Left 1159367286 18:67484492-67484514 CCTTTGAGAGGCAGGATTCGCCT 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1159367289 18:67484515-67484537 TGTCCCAGGTTGATTAAAAATGG 0: 1
1: 0
2: 0
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159367286 Original CRISPR AGGCGAATCCTGCCTCTCAA AGG (reversed) Intergenic
903571489 1:24308811-24308833 AAGCGAAGCCTGCATCACAAAGG - Intergenic
904197101 1:28794156-28794178 AGGCTTCTCCTGCCTCTCATAGG - Intergenic
908480885 1:64537852-64537874 AGGCAAATCCAACCTCTCCAAGG + Intronic
909481592 1:76132789-76132811 TGGGGGATCCTGCCTCTTAAAGG + Intronic
916548173 1:165826567-165826589 AGGCTAGTCCTGCCTCTCTCAGG + Intronic
920926756 1:210348697-210348719 ATGTGCATCCTGCCTGTCAAAGG - Intronic
921921605 1:220676243-220676265 AGGTAAATACTGCCTCTCAGAGG - Intergenic
924430997 1:243996381-243996403 AGGCACATCCTGTCTCTCAAGGG + Intergenic
1066550599 10:36552504-36552526 TGCCGAAGCCTGGCTCTCAATGG + Intergenic
1067067650 10:43112764-43112786 AGGCAGATCCTGCCCCTCTAGGG - Intronic
1067699265 10:48556918-48556940 AGGCAAATCCTGGCTTTCACAGG + Intronic
1069691480 10:70355903-70355925 ACACGAATCCTGCATCTCAGAGG + Intronic
1069695131 10:70380875-70380897 AGGCTCATCCTGCCTCCCAGTGG - Intronic
1075932761 10:126313356-126313378 AGACCAACCCTGCCTCACAAAGG + Intronic
1076109510 10:127850068-127850090 AGGCGAATCCTTCCCCTTAGAGG + Intergenic
1077286482 11:1768229-1768251 AGCCCAACCCTGCCTCTCCATGG + Intergenic
1078822125 11:14892530-14892552 AGGCGGATCCTGCCTCTCTGGGG + Intergenic
1080290701 11:30667903-30667925 AGGAGACTCATGTCTCTCAAAGG + Intergenic
1082081158 11:48013539-48013561 AGGAGAATCTTGCTTCTCATGGG + Intronic
1085981948 11:81735758-81735780 GAGCTAATCCTGCCTCTCCAAGG + Intergenic
1086498090 11:87424683-87424705 TGGCGACTCCTGCCTCTCACTGG + Intergenic
1090777153 11:129975647-129975669 AGGCAAACCCTGCCTCCCACTGG + Intronic
1092319762 12:7459988-7460010 AGGGGAATCCTTCATCCCAATGG + Intronic
1093000525 12:13990882-13990904 AGGGAAATCTTGCATCTCAAAGG + Intergenic
1095044218 12:37482615-37482637 AGGCCAATAATGCCTCTGAAAGG + Intergenic
1096490754 12:52011535-52011557 AGGCCAATCCTGCCCCAAAATGG + Intronic
1098482162 12:70976393-70976415 ACACGGATCCTGCCTCTCAGTGG - Intergenic
1099256480 12:80320512-80320534 AGGCGAATTCAGCCTTTCATCGG + Exonic
1103075714 12:117980959-117980981 GAGTGAACCCTGCCTCTCAAAGG + Intergenic
1103179484 12:118897438-118897460 ATGCCAATTCTGCCTCTCATAGG + Intergenic
1104324948 12:127786812-127786834 AGGCGAATTCTGAATGTCAAAGG - Intergenic
1110615406 13:77536094-77536116 TGGTGAATCCTGCCACACAAAGG + Intronic
1110988691 13:82009214-82009236 AGGGGAACACTGCCACTCAAAGG - Intergenic
1122321185 14:100856755-100856777 AGGCGTTTCCAGCCTCTCAGAGG - Intergenic
1124216147 15:27808416-27808438 AAGTGAATCCTGCCTCCCAGCGG - Intronic
1127823612 15:62683394-62683416 TAGCGAATCCTGCCTCTCATTGG + Intronic
1128778232 15:70340390-70340412 AGGGGAATCTTGCCACTCAATGG - Intergenic
1135164850 16:20130059-20130081 AGGCAAGCTCTGCCTCTCAAGGG - Intergenic
1136860745 16:33700477-33700499 AGGCTAGTCATGCCTTTCAAAGG + Intergenic
1141267443 16:82509627-82509649 AGGAGAATCCTGCCTGAGAAAGG - Intergenic
1141713259 16:85712512-85712534 AGGTGTAACCTGCCTCTCAGAGG - Intronic
1142859294 17:2751094-2751116 AGGGGCACCCTGCCTCTCTATGG + Intergenic
1143345260 17:6244523-6244545 AGACGACTCCTGCCTCTCCAGGG + Intergenic
1147430546 17:40367824-40367846 AGGCCAATCCTGCCTCGCTCCGG + Intergenic
1148998505 17:51733317-51733339 AGGCGAAGCGTGGCTTTCAATGG - Intronic
1151038931 17:70835467-70835489 TGGCCAAGCCTGCCTCTCCACGG + Intergenic
1151582608 17:74988688-74988710 AAGCGACTCCTGACTCTCGAAGG - Intronic
1153258196 18:3194421-3194443 AGGCAACTCCTGCCTTTGAAGGG + Intronic
1159367286 18:67484492-67484514 AGGCGAATCCTGCCTCTCAAAGG - Intergenic
1161137890 19:2631157-2631179 AGGCAGTGCCTGCCTCTCAAGGG - Intronic
1164800745 19:31074095-31074117 ATGCTAATCATGCCTCTCAAAGG + Intergenic
927099810 2:19779451-19779473 AGGAGGATCCTGCCCCTGAAAGG + Intergenic
930158777 2:48131735-48131757 AGGCTAATACTGCTTCTCAAAGG - Intergenic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
937047790 2:118861239-118861261 AGTCGAACACTGCCTCTCAATGG - Intergenic
940147510 2:150562224-150562246 AGGCTTATCCTGACTCACAAGGG - Intergenic
948692674 2:239716629-239716651 AGGAGGTTCCAGCCTCTCAAGGG + Intergenic
1171538760 20:25926235-25926257 AGGCCAATAATGCCTCTGAAAGG + Intergenic
1171802274 20:29634039-29634061 AGGCCAATAATGCCTCTGAAAGG - Intergenic
1171841700 20:30221551-30221573 AGGCCAATAATGCCTCTGAAAGG + Intergenic
1173583932 20:44167410-44167432 ATGGGTTTCCTGCCTCTCAAAGG - Intronic
1173904480 20:46616153-46616175 AGGCAGATCCTGCATCTCAGAGG + Intronic
1174076365 20:47940148-47940170 AGGCGAGTCATCCCTGTCAAAGG - Intergenic
1174770471 20:53294836-53294858 ATGGGAATCCTGCTTTTCAAAGG - Intronic
1182060789 22:27395631-27395653 AGGCCATTCCTACCTCTGAATGG + Intergenic
1182098574 22:27642194-27642216 AGGCGGCTCCTTCCTCTGAAAGG + Intergenic
951803834 3:26624433-26624455 AGGGGACTCCTGCCTCCCAGGGG + Intronic
953392266 3:42540541-42540563 GGGCGATTCCTGCCACTCCAGGG + Intergenic
956891631 3:73619929-73619951 AGGCCAATTTTGCCCCTCAAGGG + Intronic
956935078 3:74091097-74091119 AGGTGAACCATCCCTCTCAAAGG - Intergenic
960790435 3:121424372-121424394 AGGAGAGTCCAGCCTATCAAAGG + Exonic
961397632 3:126607577-126607599 AGGTGAATGGTGCCACTCAAAGG + Intronic
970779165 4:19714719-19714741 AGACATACCCTGCCTCTCAATGG + Intergenic
978871433 4:113583016-113583038 AGTCAAATCCTGCCTTTAAAAGG + Intronic
985629782 5:1008531-1008553 AGGCGGGTCCTCCCTTTCAAAGG + Intergenic
988420084 5:30994950-30994972 AGGCTCTTCCAGCCTCTCAAAGG + Intergenic
991480512 5:67073435-67073457 AGCCGAGTCCTGCCTCTGCAGGG - Intronic
995891316 5:116955338-116955360 AGGCTAATGCTGCTTGTCAAGGG + Intergenic
997465837 5:134087513-134087535 AGGCGAGTACTGCCTTTCAGTGG - Intergenic
999007735 5:148001401-148001423 AGGCCAAGGCTGCCTCTTAAGGG + Intergenic
1003645192 6:7909321-7909343 AGGCTATTCCAACCTCTCAAAGG + Intronic
1007036255 6:38677018-38677040 AGGCAAATGCAGCCTCTGAAGGG + Exonic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1017711036 6:157168178-157168200 AGGCGAGCCCAGCCTCTCACTGG - Intronic
1017869548 6:158475234-158475256 AGGAGAAGCCTGCCCCTCCATGG + Intronic
1022056386 7:26739622-26739644 AGCTGTTTCCTGCCTCTCAAAGG - Intronic
1022898198 7:34774225-34774247 AGGCCAATCCTGGCTGACAATGG - Intronic
1026592736 7:71710989-71711011 AGGGGAATCCTGCTTCCCCAGGG + Intronic
1032465973 7:132145287-132145309 GGACGTATCCTGCCTCTCCAGGG - Exonic
1032616962 7:133483233-133483255 AGGCCCTTCCTGCCTCTCCATGG - Intronic
1034416742 7:150969260-150969282 AGAGGAATCCTGCCTTTCACAGG + Intronic
1039751791 8:40485645-40485667 TGGCAAATGCTTCCTCTCAAAGG + Intergenic
1054166280 9:61733247-61733269 AGGCCAATAATGCCTCTGAAAGG - Intergenic
1055101797 9:72473236-72473258 AGGCAAATCCTGCTACTCACTGG + Intergenic
1059319320 9:113455794-113455816 AGGCAAATCCTTCATTTCAAGGG + Intronic
1059723674 9:116985791-116985813 AGGAGAAGCCAGCCTCTCACCGG - Intronic
1059939420 9:119343533-119343555 AAGCCATTCCTGCCTCCCAAAGG + Intronic
1062200274 9:135299185-135299207 ACGCAGACCCTGCCTCTCAATGG + Intergenic
1192223720 X:69214609-69214631 AGGTGAATCCTGCCGCTAAGAGG - Intergenic
1194673216 X:96761325-96761347 AAACCAATGCTGCCTCTCAATGG - Intronic
1198004977 X:132483841-132483863 ATGCAAATCCAGCCTCTAAATGG + Intronic