ID: 1159369897

View in Genome Browser
Species Human (GRCh38)
Location 18:67516633-67516655
Sequence CGGGCGGCGGGTTCTCTCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 45}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159369884_1159369897 22 Left 1159369884 18:67516588-67516610 CCGGACGCTTGTGGGGGCAACCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1159369897 18:67516633-67516655 CGGGCGGCGGGTTCTCTCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1159369887_1159369897 2 Left 1159369887 18:67516608-67516630 CCACGGACCGCAGGACAGAGACC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1159369897 18:67516633-67516655 CGGGCGGCGGGTTCTCTCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 45
1159369890_1159369897 -5 Left 1159369890 18:67516615-67516637 CCGCAGGACAGAGACCCGCGGGC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1159369897 18:67516633-67516655 CGGGCGGCGGGTTCTCTCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159369897 Original CRISPR CGGGCGGCGGGTTCTCTCGG TGG Exonic