ID: 1159382301

View in Genome Browser
Species Human (GRCh38)
Location 18:67676038-67676060
Sequence TTTGCCAGTAATGTGGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159382296_1159382301 19 Left 1159382296 18:67675996-67676018 CCACTTATTCAGTGGGAAGAAAG No data
Right 1159382301 18:67676038-67676060 TTTGCCAGTAATGTGGGATGTGG 0: 1
1: 0
2: 2
3: 9
4: 175
1159382297_1159382301 -6 Left 1159382297 18:67676021-67676043 CCTTGAATCCTCTTCACTTTGCC 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1159382301 18:67676038-67676060 TTTGCCAGTAATGTGGGATGTGG 0: 1
1: 0
2: 2
3: 9
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159382301 Original CRISPR TTTGCCAGTAATGTGGGATG TGG Intergenic
901917276 1:12509533-12509555 ATTCCCAGTAAAGTGGGTTGAGG + Exonic
904488413 1:30843125-30843147 TTTGCCAGTTATGTGGGTAGAGG - Intergenic
906214398 1:44030551-44030573 TGTGCCGGTAATGAGGGTTGGGG + Intronic
906456523 1:46002000-46002022 TTTGCCTGGACTGTGGGATGTGG - Intronic
907951803 1:59190331-59190353 TTTCCCAGGGATGTGGGGTGAGG + Intergenic
908405309 1:63808663-63808685 TTGGCCAGAAATGTGTCATGTGG + Intronic
910687267 1:89930076-89930098 TTTTCCAGAAATGGGGGTTGGGG - Intronic
912666801 1:111588361-111588383 TCTGGTAGTAATGTGGTATGTGG - Intronic
915595532 1:156894522-156894544 TTTGCCAGTTATGAGGACTGGGG + Intronic
916509166 1:165455909-165455931 TTGGCCAGGATTGGGGGATGTGG - Intergenic
918141105 1:181720632-181720654 TTTGTAAGTTATGTGGAATGGGG + Intronic
918492622 1:185098301-185098323 TTTTCCATAAGTGTGGGATGAGG - Exonic
919420089 1:197359237-197359259 TTTGCCAGGGATAAGGGATGAGG - Intronic
921904833 1:220485332-220485354 TCTGCCAGTCCTTTGGGATGAGG - Intergenic
922365960 1:224864028-224864050 TTTGGCAGCCATTTGGGATGTGG - Intergenic
924675170 1:246168552-246168574 ATTCCCAGGAATGTGTGATGGGG - Intronic
1066253289 10:33654666-33654688 ATTGCCTGTAATGTGGGGAGAGG - Intergenic
1066286836 10:33975756-33975778 TTTGCCAGAAATCTGGAATAAGG - Intergenic
1067241402 10:44497741-44497763 TTGGCCAATTTTGTGGGATGTGG - Intergenic
1068797793 10:61103110-61103132 CTTCCCAGTAAAGAGGGATGGGG + Intergenic
1072473235 10:95733709-95733731 TTTGGTAGTAATGGAGGATGGGG + Intronic
1073741527 10:106413111-106413133 TTTCCCATGAATGTGGGTTGGGG - Intergenic
1074362308 10:112833278-112833300 TATGCAGGTGATGTGGGATGTGG - Intergenic
1075067426 10:119298848-119298870 TTGGCCAGGAGTGGGGGATGTGG - Intronic
1077665193 11:4101734-4101756 TTTGGCTGCCATGTGGGATGGGG + Intronic
1078040177 11:7853939-7853961 TTTGCCAGCCACGTTGGATGTGG + Intergenic
1078474431 11:11619461-11619483 GGTGCCAGTCATGTGGAATGTGG - Intronic
1079091122 11:17480896-17480918 TCTGCCAGTCTAGTGGGATGGGG + Intergenic
1080148151 11:29014682-29014704 TTTGTCAGTACTGTGGGTTAGGG - Intergenic
1080729600 11:34936043-34936065 TTTGCCACTAATGACAGATGTGG + Intronic
1081150020 11:39616471-39616493 TTGGTCAGAAATGTGGGAGGAGG + Intergenic
1082309827 11:50632873-50632895 TTTGCCTGTAATATGGCGTGTGG + Intergenic
1083351768 11:62034575-62034597 TTGGCCAGTAATGAGGGTAGGGG + Intergenic
1090924389 11:131236729-131236751 TTTGACAGTAATGTGTTCTGGGG - Intergenic
1093143025 12:15532411-15532433 TTTGAAAGTCATGTGGGATGTGG + Intronic
1095183750 12:39177752-39177774 TTTGCCACTAATGTTGCCTGGGG - Intergenic
1095616172 12:44192130-44192152 TATACCAGTAATGTGGGAAGTGG + Intronic
1098172174 12:67758144-67758166 TGTGGCAGTATTGAGGGATGGGG + Intergenic
1098859469 12:75691069-75691091 TTTGCCAATAATATGGAATTTGG + Intergenic
1100644553 12:96515330-96515352 GGTGCCAGTCTTGTGGGATGGGG + Intronic
1101439883 12:104695713-104695735 TTTGCCAGAAATGGGGGCGGGGG + Intronic
1102452944 12:113055416-113055438 TTTGCCTGTAATGGGAGAGGGGG + Intergenic
1106987868 13:35376916-35376938 TTTGCTAGGAATGTGGGACAGGG - Intronic
1108723786 13:53159426-53159448 TTTCCCAGTAATGTGATATTGGG + Intergenic
1108992632 13:56681308-56681330 ATTACCAGAAATGTGGCATGTGG + Intergenic
1109999404 13:70175280-70175302 TTTGACATTACTGTAGGATGTGG + Intergenic
1112936332 13:104804259-104804281 CTTGCCTGGAATCTGGGATGAGG - Intergenic
1118506376 14:66417124-66417146 TTTGCCTGTGAGGTGAGATGGGG - Intergenic
1119157054 14:72421198-72421220 TTCACCAGAAATGTGGGGTGAGG + Intronic
1122309672 14:100786431-100786453 CATGCCAGGGATGTGGGATGGGG + Intergenic
1122313952 14:100814848-100814870 CCTGCCAGGAATGTGGGCTGTGG + Intergenic
1123875713 15:24621947-24621969 CATGCCAGTAAAGTGGCATGGGG + Intergenic
1126099908 15:45112800-45112822 TCTGTCAGTGAAGTGGGATGGGG - Intronic
1126898690 15:53287984-53288006 TTAGCCAGTGTTGTGGGAGGAGG + Intergenic
1128129882 15:65219305-65219327 GTTGTCAGTAATTGGGGATGGGG - Intergenic
1128518443 15:68359000-68359022 GTGGCTAGAAATGTGGGATGTGG + Intronic
1128846953 15:70907421-70907443 TTTGACAGCAATGTGGGGTCGGG - Intronic
1128851450 15:70961727-70961749 GTTGCCAGTGATTTGGGAGGAGG + Intronic
1131105797 15:89733475-89733497 TGTGGCAGTACTGTGAGATGGGG + Intronic
1131389137 15:92033010-92033032 TTAGCTGGTAGTGTGGGATGTGG + Intronic
1132064844 15:98722446-98722468 TTTGCCAGGCATTTGGAATGTGG + Intronic
1135348743 16:21711237-21711259 TTTGCCATTACTTTGGGATTAGG + Intronic
1135461169 16:22644329-22644351 TGTGTCAGAAATGTGGGATCTGG + Intergenic
1135727729 16:24869916-24869938 TTTGCCAGCAATGTTGGAAGTGG + Exonic
1137484648 16:48881241-48881263 CTTGCCAATATTTTGGGATGGGG + Intergenic
1140080273 16:71739961-71739983 TTTACCAGTAATGATGGAAGTGG + Intronic
1145290089 17:21536228-21536250 GTTGCCAGGGCTGTGGGATGGGG + Intronic
1145392319 17:22465286-22465308 TTTGCCAGGAAGTGGGGATGGGG - Intergenic
1146573447 17:33972014-33972036 TTTCCCAACAATGCGGGATGGGG + Intronic
1146675568 17:34771685-34771707 TTTGCAAGTCGCGTGGGATGTGG + Intergenic
1147176542 17:38659372-38659394 CTTGCCAGGGATGTGGGAAGGGG - Intergenic
1155466582 18:26142527-26142549 TTTATCAGTAATGTAGGATAAGG + Intronic
1157441341 18:47714130-47714152 TTTCCCAGTCATAAGGGATGGGG + Intergenic
1159382301 18:67676038-67676060 TTTGCCAGTAATGTGGGATGTGG + Intergenic
1159693988 18:71530104-71530126 TTTGCCCATAATGTTGGCTGTGG - Intergenic
1159798550 18:72869433-72869455 CCTGCCAGTAAGTTGGGATGAGG + Intergenic
1159856759 18:73598286-73598308 TGTGGCCGTATTGTGGGATGTGG + Intergenic
1160142296 18:76336415-76336437 ATTTCCAGTAATCTGGAATGTGG - Intergenic
1166717649 19:44978773-44978795 TGTGCCAGTACTGAGAGATGAGG - Intronic
926776770 2:16430893-16430915 GTTGCCAGTGATGTGGGTGGTGG - Intergenic
926931795 2:18048389-18048411 GTTTCCAGAAATGTTGGATGAGG - Intronic
932435001 2:71697917-71697939 GATGCCAGGAATGTGGAATGTGG + Intergenic
932752606 2:74380811-74380833 TTTGCCAGCCTTGTGGGAGGGGG - Intronic
932820413 2:74895017-74895039 TTTGCCAGTATTATGGTCTGTGG - Intergenic
932991233 2:76790254-76790276 TTTGTCAGTACGGTGGTATGGGG + Intronic
933234070 2:79844871-79844893 TTAGCCAGGAGTGTGGGCTGGGG + Intronic
933304811 2:80584323-80584345 TTTGAGAGCAATGTTGGATGGGG - Intronic
934085697 2:88507369-88507391 TTTGGCAGGAATGGGGGATATGG + Intergenic
936320645 2:111464225-111464247 TAAGCCAGTGATGGGGGATGGGG - Intergenic
937932563 2:127218595-127218617 TTTTCCATTAATGAGGGTTGGGG + Intronic
938654884 2:133421204-133421226 TTTAGCTGTAATGTGGAATGAGG - Intronic
939089030 2:137757466-137757488 TATGCCAGCAAAGTGGCATGGGG - Intergenic
939402105 2:141708142-141708164 TGTGCCATTAATTTGGAATGGGG - Intronic
942637480 2:178023440-178023462 TTTGCCATGAATGTGGGACCTGG - Intronic
944332742 2:198490890-198490912 TTTGCCATTAATATGAAATGTGG - Intronic
946132047 2:217614024-217614046 CTTGACAGTGATGTGGTATGGGG + Intronic
1169977313 20:11344755-11344777 GTGGCCAGTAGTCTGGGATGTGG - Intergenic
1171886211 20:30654057-30654079 GTTCCCAGTAATGAGTGATGAGG + Intergenic
1172847404 20:37938148-37938170 TTTGCCAGTGCTGAGGGATGTGG + Intronic
1177971650 21:27797558-27797580 TTTGCCAGAAGTGTGGGGTAGGG - Intergenic
1179965705 21:44803595-44803617 TTTTCCAGTTATGGGAGATGTGG + Intergenic
1181662619 22:24363898-24363920 TTAGCCAGTAAAGTGGGCGGTGG + Intronic
951259461 3:20489865-20489887 TTTGCCAGGAATGTGGCCTAGGG - Intergenic
951314023 3:21166108-21166130 TTTGTTACTACTGTGGGATGGGG + Intergenic
954504796 3:51059496-51059518 ATTAAAAGTAATGTGGGATGTGG - Intronic
954809835 3:53241062-53241084 TTTCCCAGACATGTGGGACGGGG - Intronic
957581085 3:82074207-82074229 TTTCCCACTGATCTGGGATGTGG + Intergenic
957966708 3:87331095-87331117 TTTTCAAATTATGTGGGATGAGG + Intergenic
958689176 3:97439785-97439807 TCTACCAGTAATGTAAGATGGGG - Intronic
959920844 3:111866530-111866552 TTGATCAGTAGTGTGGGATGGGG + Intronic
960848410 3:122026376-122026398 TTTGACAGTTATGTAGAATGTGG + Intergenic
961863063 3:129933587-129933609 TCTCCCTGGAATGTGGGATGTGG + Intergenic
964879108 3:161404058-161404080 TTTGGCAGTATTGAGAGATGGGG + Intergenic
965332840 3:167398813-167398835 TGTGACAGTATTGAGGGATGGGG + Intergenic
966057994 3:175719194-175719216 GTTGTCACAAATGTGGGATGGGG + Intronic
967821298 3:193841795-193841817 TTTGGCAGTAATGGCGGGTGTGG + Intergenic
970064316 4:12074539-12074561 TGTGCCTGTAATGTGGTATTTGG + Intergenic
971685208 4:29756996-29757018 GTTGCCAGTACTGGGGGATGGGG - Intergenic
971969954 4:33607253-33607275 TTTGCCAGCAAAGTGATATGAGG - Intergenic
975534131 4:75431385-75431407 GTTGGCAGTAAGGTGGGCTGGGG - Intergenic
975542567 4:75530016-75530038 TTATCCAGTAATGTGTTATGTGG + Exonic
977796608 4:101173187-101173209 TTTGCCTTTATTGGGGGATGAGG + Intronic
979902606 4:126241872-126241894 ATTGCCAATAATGTGGGGTGGGG + Intergenic
981791304 4:148540129-148540151 CATCCCAGTAATGTGGGAGGTGG + Intergenic
982077412 4:151751421-151751443 TTTGGCGGTGAGGTGGGATGTGG - Intronic
984137556 4:175959987-175960009 CTTGCTTGTAAAGTGGGATGTGG - Intronic
986063586 5:4214331-4214353 TTTGCCACTAATGGTGGATCCGG + Intergenic
987491435 5:18584542-18584564 GATGCCAGTAATATTGGATGAGG + Intergenic
991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG + Intronic
992072460 5:73160613-73160635 CTTGCCAGTAAAGAAGGATGAGG + Intergenic
992712137 5:79469781-79469803 TTTGAAAGTAATGTGGGGCGAGG - Intronic
993841071 5:92879419-92879441 TGTGCCAGTAATCTGAGAAGAGG + Intergenic
995070051 5:107910095-107910117 TTTGCTTGCAGTGTGGGATGGGG + Intronic
995968682 5:117940744-117940766 CTAGGGAGTAATGTGGGATGGGG - Intergenic
999031568 5:148298956-148298978 TTCGGGAGTAATGTGGGATATGG - Intergenic
1003739992 6:8925575-8925597 TTTGCCAGTAAGTTGTGGTGAGG - Intergenic
1005260137 6:24050185-24050207 TTGGGCAGTAATGTGTGATGGGG - Intergenic
1007472362 6:42099232-42099254 TTTGCCAGCAATGTGAGAAAAGG - Intergenic
1009898860 6:69786527-69786549 TTGGCCAGTAACATTGGATGGGG - Intronic
1009903694 6:69841843-69841865 TTTTCCAGTAAAGTGGGGAGGGG + Intergenic
1014508238 6:122285792-122285814 TTTGCCAGTCCTATGTGATGAGG - Intergenic
1015982404 6:138852467-138852489 TCTTCCATTATTGTGGGATGAGG + Intronic
1017654827 6:156617578-156617600 TTTGCCAGTCATTTGGAATTAGG - Intergenic
1018070048 6:160156332-160156354 TTTGTCTGTAATGTTGGCTGTGG + Intronic
1019477542 7:1251266-1251288 TGTGCCTGTATTTTGGGATGGGG + Intergenic
1020159492 7:5758570-5758592 TGTGCCATGAATGTGAGATGTGG + Intronic
1020863186 7:13520961-13520983 TTTGACAATCATGTGAGATGTGG + Intergenic
1020911778 7:14140279-14140301 TTTTCCATGAATGGGGGATGGGG + Intergenic
1023630736 7:42161792-42161814 TTTCCCAATTATGTGGGAAGAGG - Intronic
1027008072 7:74713965-74713987 TTTGCCTGTAATGTGTAGTGTGG + Intronic
1029860163 7:103562636-103562658 TTTGTCTGTTATGTGGAATGTGG + Intronic
1029867660 7:103652572-103652594 TTTTCCATCAATCTGGGATGTGG - Exonic
1030738912 7:113085476-113085498 TTTGCCAGAAATGGGGGGTAGGG - Intronic
1036185626 8:6620396-6620418 TTTGTGAGTGATGTGGGCTGTGG + Intronic
1037234865 8:16706228-16706250 TGTGACAGTATTGAGGGATGTGG + Intergenic
1045204612 8:100025184-100025206 TTTGCTAGTAAAGTGGGTTCAGG - Intronic
1045906060 8:107346364-107346386 TTTGCCAGTAAACTATGATGGGG + Intronic
1050540938 9:6669294-6669316 TTTTCCATAAGTGTGGGATGAGG + Intergenic
1051985613 9:23083260-23083282 TTTGAAAGGAATTTGGGATGGGG + Intergenic
1052189492 9:25642081-25642103 TTTTCCACAAATGGGGGATGGGG + Intergenic
1052304402 9:26989678-26989700 TTTGTCAGTTGTTTGGGATGGGG + Intronic
1057888038 9:98845921-98845943 TTTTCCACTGATGTGGGAAGAGG - Intronic
1057970581 9:99553661-99553683 TCTGCCAGTAATGTGGGGTGTGG + Intergenic
1059297487 9:113284762-113284784 CTTACCTGTAAAGTGGGATGAGG + Intronic
1059604108 9:115814446-115814468 GTTGCAAGTAATTAGGGATGAGG + Intergenic
1059936977 9:119321295-119321317 TTTGCCAGCTTTGTGGTATGAGG - Intronic
1060173387 9:121479599-121479621 TTATCCAGTAGTGTGTGATGTGG - Intergenic
1060307115 9:122423833-122423855 TCTGCCATGAATGTGGAATGGGG - Intergenic
1060696081 9:125710266-125710288 TTTGCCAGACAGGTGTGATGGGG + Intergenic
1062050432 9:134444148-134444170 TTTGCCCATTATGGGGGATGGGG + Intergenic
1185728141 X:2439482-2439504 TTTTCCACTGATGTGGGGTGGGG + Intronic
1186772458 X:12831182-12831204 GTTGTCACAAATGTGGGATGGGG - Intergenic
1187264186 X:17716244-17716266 TTTTCCAGTAGTGAGGGGTGAGG - Intronic
1187921257 X:24204233-24204255 TTTGCAAGTAATTTGGGATGTGG + Intronic
1188006468 X:25019215-25019237 TTTGCAAGAAATGTGGAATAAGG + Intergenic
1191011242 X:55761759-55761781 TTAAGCAGTAATGTGGGAAGGGG + Intergenic
1191225401 X:58037555-58037577 TTTGGCAGTATTGGGAGATGGGG + Intergenic
1195968965 X:110453973-110453995 TGTGGCAGTCATGTGCGATGTGG - Exonic
1196431179 X:115627787-115627809 TTTACCAGTAATTTTGGAGGTGG - Intronic
1199573712 X:149292690-149292712 TTTGGCAGTATTGAGAGATGGGG - Intergenic
1201794196 Y:17876968-17876990 TTTGCCTGTTATCTGTGATGAGG - Intergenic
1201807358 Y:18029017-18029039 TTTGCCTGTTATCTGTGATGAGG + Intergenic
1201951650 Y:19571789-19571811 TTTGCAGGTGGTGTGGGATGGGG + Intergenic
1202125227 Y:21563648-21563670 TTGCCCAGTAATGGGGGATAAGG + Intergenic
1202153781 Y:21865744-21865766 TTGCCCAGTAATGGGGGATAAGG - Intergenic
1202355578 Y:24044787-24044809 TTTGCCTGTTATCTGTGATGAGG - Intergenic
1202515200 Y:25625322-25625344 TTTGCCTGTTATCTGTGATGAGG + Intergenic