ID: 1159388205

View in Genome Browser
Species Human (GRCh38)
Location 18:67754701-67754723
Sequence GACCCCCTGGGAAAGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159388202_1159388205 2 Left 1159388202 18:67754676-67754698 CCTCTAAACAGGGAAAATGTGAG No data
Right 1159388205 18:67754701-67754723 GACCCCCTGGGAAAGCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159388205 Original CRISPR GACCCCCTGGGAAAGCTGAG TGG Intergenic
No off target data available for this crispr