ID: 1159390848

View in Genome Browser
Species Human (GRCh38)
Location 18:67790026-67790048
Sequence GATACAAAAGCAACCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159390848_1159390851 13 Left 1159390848 18:67790026-67790048 CCCACTTGGGTTGCTTTTGTATC 0: 1
1: 1
2: 0
3: 27
4: 230
Right 1159390851 18:67790062-67790084 TTCTCTGGACCTTGTAGTTGAGG 0: 1
1: 0
2: 3
3: 13
4: 182
1159390848_1159390850 -2 Left 1159390848 18:67790026-67790048 CCCACTTGGGTTGCTTTTGTATC 0: 1
1: 1
2: 0
3: 27
4: 230
Right 1159390850 18:67790047-67790069 TCGTTGTTGCTTTTGTTCTCTGG 0: 1
1: 0
2: 1
3: 39
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159390848 Original CRISPR GATACAAAAGCAACCCAAGT GGG (reversed) Intergenic
901756108 1:11442518-11442540 GCTACAAAAGCCACACAGGTTGG - Intergenic
904927356 1:34059413-34059435 AATACTCAAGCCACCCAAGTAGG + Intronic
908893383 1:68870848-68870870 TATACAAAATCAACTCAAGATGG + Intergenic
909073617 1:71026585-71026607 GAGACAAAAGCAGCCTAAGGGGG - Intronic
909848489 1:80429718-80429740 GAAATAAAAGCCACCCAAATTGG - Intergenic
910631042 1:89354577-89354599 GATCCAAAAGAAATCCAAGTGGG - Intergenic
910631048 1:89354639-89354661 GATCTAAAAGAAATCCAAGTGGG - Intergenic
913663472 1:121026073-121026095 GAAATAAAAGCAATCCAAATAGG + Intergenic
914014863 1:143809342-143809364 GAAATAAAAGCAATCCAAATAGG + Intergenic
914162958 1:145151865-145151887 GAAATAAAAGCAATCCAAATAGG - Intergenic
914653484 1:149717898-149717920 GAAATAAAAGCAATCCAAATAGG + Intergenic
915547416 1:156608864-156608886 CATAAAAAAGCAACCCAAATGGG - Intergenic
915867626 1:159521347-159521369 TATACAAAATCAACTCAAGATGG - Intergenic
916644913 1:166774670-166774692 TATACAAAATCAACTCAAGATGG + Intergenic
916837578 1:168563774-168563796 TATACAAAATCAACTCAAGATGG + Intergenic
917929626 1:179814272-179814294 GAAACAGAAACAACCCATGTGGG - Exonic
918217294 1:182403079-182403101 GATACAGAAACAACCTAAGTTGG - Intergenic
918603131 1:186387458-186387480 GATACAAAAGCAAGGAAAGTGGG - Intronic
919386179 1:196925615-196925637 GATACAAAGGCCATCCAAGTTGG - Intronic
922069611 1:222178552-222178574 GAAACAAAAGGAATCCAAATAGG + Intergenic
923353565 1:233131700-233131722 GAGACAAAAGCAAGGAAAGTAGG - Intronic
923426675 1:233877060-233877082 GAAACTACAGCAACCCAATTTGG + Intergenic
924811067 1:247402584-247402606 GACACATAAGCACCCCAAGTAGG + Intergenic
1068094691 10:52476251-52476273 GAAATAAAAGCCACCCAAATTGG + Intergenic
1071005372 10:80878076-80878098 GAAAAAAAATCAACCCAAGATGG - Intergenic
1071373743 10:84981170-84981192 TATACAAAATCAACTCAAGATGG + Intergenic
1071652389 10:87405296-87405318 GAAACAAAAGGAATCCAAATAGG + Intergenic
1073946033 10:108751658-108751680 GAAACAAATGCAACTAAAGTTGG - Intergenic
1076069503 10:127475617-127475639 GATTCAGAAGCAACACAGGTGGG - Intergenic
1077685406 11:4286701-4286723 GAAAAAAAAAAAACCCAAGTTGG - Intergenic
1078588363 11:12615136-12615158 TATACAAAATCAACTCAAGATGG + Intergenic
1079712181 11:23699371-23699393 TATACAAAATCAACTCAAGATGG + Intergenic
1081090687 11:38862576-38862598 TATACAAAATCAACTCAAGATGG - Intergenic
1082751219 11:57020224-57020246 GAAACAAAAGACACCCAAATAGG + Intergenic
1086082393 11:82918260-82918282 TATATAAAAGCAACTCAAGATGG - Intronic
1086526480 11:87733247-87733269 TATACAAAATCAACTCAAGATGG - Intergenic
1087219329 11:95529075-95529097 TATAAAAAAACAACTCAAGTTGG - Intergenic
1087300762 11:96432016-96432038 TACACAAAATCAACCCAAGATGG + Intronic
1089569379 11:119393498-119393520 TATACAAAATCAACTCAAGATGG - Intergenic
1090097122 11:123753424-123753446 GATGCAAAAGCAAACCATGATGG - Intergenic
1093391714 12:18631967-18631989 GATACAAAACTGACCCCAGTGGG - Intronic
1093492763 12:19724223-19724245 TATACAAAATCAACTCAAGAGGG + Intergenic
1093602213 12:21041728-21041750 GATACAAAAGGCATCCAAATTGG - Intronic
1097833262 12:64247987-64248009 TATACAAAATCAACTCAAGATGG - Intergenic
1098801890 12:74970856-74970878 TATACAAAAGCAACTCATGAAGG + Intergenic
1099192886 12:79578703-79578725 CATACAAAACCAACTCAAGATGG + Intronic
1099634719 12:85199268-85199290 GATACAAAATCAACTCAAGATGG - Intronic
1099654551 12:85472431-85472453 GAAACAAAAGCCATCCAAATAGG - Intergenic
1100932287 12:99623425-99623447 GATACAAAGGGCACCCAAATAGG + Intronic
1103229395 12:119315524-119315546 GATAGAAAAACAACTCAAATTGG - Intergenic
1104732280 12:131114363-131114385 GATACCAATGCAGCCCCAGTAGG + Intronic
1107742561 13:43467370-43467392 GTTAAAATAGTAACCCAAGTGGG + Intronic
1107775063 13:43830170-43830192 AATAGAAAAGCAAGCCAGGTTGG - Intronic
1107967099 13:45607036-45607058 GATAAAAAAACAACCCCAGAGGG + Intronic
1108128454 13:47270462-47270484 TATACAAAATCAACTCAAGATGG + Intergenic
1108464655 13:50702794-50702816 AATACAAAATCAACTCAAATTGG + Intronic
1108741050 13:53338764-53338786 GAAACCAAAGGGACCCAAGTTGG - Intergenic
1108878803 13:55083499-55083521 GAAACAAAGGCCATCCAAGTTGG - Intergenic
1109196888 13:59387783-59387805 TATACAAAATCAACTCAAGGTGG - Intergenic
1110012219 13:70351206-70351228 TATACAAAATCAACTCAAGATGG - Intergenic
1110876401 13:80516294-80516316 TATACAAAATCAACTCAAGATGG - Intergenic
1110917508 13:81041182-81041204 GGTACAAAGGCAACTCAAGTGGG + Intergenic
1111000567 13:82174491-82174513 TATACAAAATCAACTCAAGATGG + Intergenic
1112071456 13:95855415-95855437 GATGCAAAAGCAATGCAAGGAGG + Intronic
1112679957 13:101752797-101752819 CATAGAACAGCATCCCAAGTAGG + Intronic
1113512505 13:110867375-110867397 GAGACAAAAGCAAACCAGGCTGG - Intergenic
1114135197 14:19840275-19840297 GATATGAAACCAACCTAAGTGGG + Intergenic
1115729846 14:36256806-36256828 GTTTTAAAAGCAACCAAAGTAGG + Intergenic
1116102729 14:40462934-40462956 GGTAAAAAAGTAACCCATGTAGG + Intergenic
1117113176 14:52480146-52480168 TATACAAAATCAACTCAAGATGG + Intronic
1119250826 14:73152308-73152330 GATACAAAAGAAACCAAAAAAGG + Intronic
1120279020 14:82415489-82415511 TATACAAAATCAACTCAAGAGGG - Intergenic
1121362728 14:93276752-93276774 GAGACAAAAGCAAACAAAGCTGG + Intronic
1121989345 14:98540082-98540104 AAAAAAAAAGCAACCCAGGTGGG + Intergenic
1126561099 15:50045150-50045172 TATACAAAAACAATCCTAGTAGG - Intronic
1127930088 15:63589835-63589857 GATACAGATGAAACCCAAATTGG - Intronic
1128150481 15:65360578-65360600 AAAACAAAAATAACCCAAGTTGG + Intronic
1129495890 15:75979909-75979931 GATACAAAAGCTAACAAAGAAGG - Intronic
1131320295 15:91382961-91382983 AAAACAAAAACAAACCAAGTAGG + Intergenic
1137906081 16:52323295-52323317 GGGACAAATGCAAGCCAAGTGGG + Intergenic
1138982175 16:62282561-62282583 GATAGAAAAGTAATCCAATTTGG + Intergenic
1139089256 16:63624310-63624332 GATACAAAGGTAACCAAAGAAGG - Intergenic
1139784324 16:69379322-69379344 GATATACAAGCACCCCAAATGGG + Intronic
1147529664 17:41263542-41263564 GTAACAAAAGCAACCACAGTTGG - Intergenic
1148400186 17:47352248-47352270 TATACAAAATCAACTCAAGATGG - Intronic
1148407834 17:47434874-47434896 TATACAAAATCAACTCAAGATGG + Intronic
1148892393 17:50817498-50817520 AATTCACAAGCAGCCCAAGTAGG - Intergenic
1150048167 17:61933592-61933614 TATAAAAAATCAACTCAAGTTGG - Intergenic
1151112825 17:71699415-71699437 GAAACAAAAGCATCTCAATTGGG + Intergenic
1151717516 17:75838727-75838749 GAGACGAAAGCAACTGAAGTGGG + Intronic
1152317697 17:79590501-79590523 AATAAAAAAGCAACCCAAGGGGG - Intergenic
1153943910 18:10002143-10002165 GAAACAAAAGTGACCCAAATTGG + Intergenic
1155933778 18:31733547-31733569 GAAATAAAAGGAATCCAAGTTGG + Intergenic
1158483768 18:57846199-57846221 CATAAAAAAGCAAGCCAAGAAGG - Intergenic
1159150902 18:64522546-64522568 GAAACAAAAATAACCCAAGTGGG + Intergenic
1159390848 18:67790026-67790048 GATACAAAAGCAACCCAAGTGGG - Intergenic
1159503395 18:69302739-69302761 GATGCAAAAGCAAACGAAATAGG + Intergenic
1164682823 19:30146923-30146945 GAAACACAAGCAACCATAGTAGG + Intergenic
1166013466 19:39961239-39961261 TTTAAAAAAGCAACCCAAGTGGG - Intergenic
1168463802 19:56585564-56585586 GCAACAAAAGCAAAACAAGTTGG + Intronic
925127004 2:1465055-1465077 TATACAAAAACAACTCAAGATGG - Intronic
927565538 2:24109281-24109303 TATACAAAATCAACTCAAGATGG + Intronic
930429543 2:51256525-51256547 TATACAAAATCAACTCAAGATGG + Intergenic
930677113 2:54214396-54214418 TATAAAAAAGCAACACAAGATGG - Intronic
932937188 2:76117720-76117742 TATACAAAATCAACTCAAGGTGG + Intergenic
933349000 2:81128417-81128439 GATACAAGACCAACCACAGTGGG - Intergenic
938375578 2:130803725-130803747 GATACAAAAATAACCCAAAATGG + Intergenic
938907393 2:135851032-135851054 TATACAAATGCAACCTAAGGAGG + Intronic
939478443 2:142716667-142716689 CTAACAAAAGCAACCCAAGGAGG - Intergenic
943068354 2:183112676-183112698 GAAAAAAAATCAACCCAATTAGG + Intergenic
943651444 2:190462123-190462145 AATACAAAAACAAACCAAGAAGG - Intronic
944866547 2:203868095-203868117 GAAACAAATGAAACCCAGGTAGG - Intronic
946638750 2:221760032-221760054 TATACAAAATCAACTCAAGATGG - Intergenic
947258691 2:228196035-228196057 GATACAAAATCAACTCAAAGTGG + Intergenic
947273168 2:228362137-228362159 GATACAAAGGGTACCCAAGATGG - Intergenic
1170729969 20:18965206-18965228 GATACAAAAGGAACCTAACCTGG - Intergenic
1172190411 20:33058969-33058991 CACACAAATGCAACCCGAGTGGG - Intronic
1172378151 20:34463398-34463420 GATACAAAAGTCATCGAAGTAGG - Intronic
1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG + Exonic
1174983804 20:55426701-55426723 TATACAAATGGAAACCAAGTTGG - Intergenic
1175056638 20:56204661-56204683 GACACAAAGGCAGCCCAAGAAGG + Intergenic
1175288602 20:57856688-57856710 TAAAAAAAAGCAACCCAAGAAGG + Intergenic
1176272264 20:64241925-64241947 GAAACAAAAGGAACCCAAAATGG - Exonic
1176699143 21:10021771-10021793 GAAACAAAAGCCATCCAAATAGG + Intergenic
1176726631 21:10440898-10440920 GATACCACAGCAGGCCAAGTGGG - Intergenic
1178523957 21:33309301-33309323 AATAAAACACCAACCCAAGTAGG - Intergenic
1180287756 22:10766187-10766209 GATACCACAGCAGGCCAAGTGGG + Intergenic
1180572633 22:16742659-16742681 TATACAAAATCAATCCAAGATGG - Intergenic
1182113029 22:27736747-27736769 GACACCAAAGCAATCCAACTGGG + Intergenic
1182192796 22:28480744-28480766 GAAAGAAAAGCAAACCAAGAAGG + Intronic
1182954885 22:34414672-34414694 GAGAGAACAGCACCCCAAGTGGG - Intergenic
1183246730 22:36699687-36699709 CACACAAAAGAAACACAAGTTGG + Intronic
1183506343 22:38211172-38211194 GAAACAAAAGGAAGCCAAGTAGG + Intronic
1183791219 22:40071727-40071749 AACACAAAATCAATCCAAGTGGG - Intronic
1183838225 22:40475245-40475267 GATACAAAAGCCATCTAAGGTGG + Intronic
1184934368 22:47709379-47709401 GAAACAGAAGCAACCCAAAAGGG - Intergenic
949754014 3:7388262-7388284 GAAACAAAAGGCATCCAAGTAGG - Intronic
951269828 3:20610151-20610173 TATACAAAACCAACTCAAGGTGG + Intergenic
952237518 3:31495389-31495411 GATACAAAAGCAAATGCAGTGGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
955886320 3:63602502-63602524 TATACAAAAACAACTCAAGATGG - Intronic
955889867 3:63638331-63638353 TATACAAAAGTAACTCAAGATGG + Intergenic
956688177 3:71851535-71851557 GATAGAAACGCAACTCAAATTGG - Intergenic
958062010 3:88495672-88495694 TATACAAAAGTAACTCAAGATGG - Intergenic
958063857 3:88517938-88517960 TATACAAAATCAACTCAAGGTGG - Intergenic
958141532 3:89569123-89569145 GATATAAAAGACACCCAAATTGG + Intergenic
959306665 3:104675870-104675892 TATACAAAATCAACCCAAGCTGG - Intergenic
961417331 3:126769180-126769202 CATACAAAATCAACTCAAGATGG - Intronic
964057616 3:152480609-152480631 GATACAAAAGGCATCCAAGTAGG - Intergenic
965214506 3:165844631-165844653 GATACAAAAGTATCCAGAGTTGG + Intergenic
966519827 3:180860595-180860617 GAAATAAAAGACACCCAAGTTGG + Intronic
967540720 3:190664604-190664626 GATACTAAAGCATCCCAATAAGG - Intergenic
967570204 3:191019450-191019472 CAAACAAAAGCAACTGAAGTGGG + Intergenic
967741170 3:193003889-193003911 TATACAAAATCAACTCAAGATGG - Intergenic
970800510 4:19967232-19967254 GATATAAAAGGAATCCAAGTTGG - Intergenic
972208839 4:36812539-36812561 GAGGTAAAAGTAACCCAAGTAGG - Intergenic
973746017 4:53964111-53964133 GAAACAAAAACAACCCAAAAAGG + Intronic
976788177 4:88846638-88846660 AATACAAATGCAAACAAAGTTGG - Intronic
977343397 4:95788850-95788872 GGGAGAAAAGGAACCCAAGTTGG + Intergenic
977605000 4:98975240-98975262 TATACAAAATCAACCCAAATGGG - Intergenic
979159635 4:117443478-117443500 TATACAAAATCAACTCAAGATGG - Intergenic
981078672 4:140616805-140616827 GTTACCACAGGAACCCAAGTAGG - Intergenic
981648089 4:147022681-147022703 CATACAAAATCAACTCAAGGTGG - Intergenic
984551601 4:181166646-181166668 GAGACAAAAGCAACCCATATGGG + Intergenic
987715254 5:21560417-21560439 GATACAAAAACTAGCCAAGTGGG + Intergenic
988029206 5:25740260-25740282 CATACAAAATCAACCCAAAATGG + Intergenic
988162002 5:27530556-27530578 TATACAAAAGAAACCCAATCAGG - Intergenic
988345003 5:30025685-30025707 TATACAAAATCAACTCAAGATGG + Intergenic
989447747 5:41550581-41550603 TATACAAAATCAACTCAAGTTGG + Intergenic
989719915 5:44513572-44513594 GATACAAAAGCAGCACAAATTGG + Intergenic
990281591 5:54257110-54257132 GAAATAAAGGGAACCCAAGTTGG + Intronic
992279393 5:75158409-75158431 AACAAAGAAGCAACCCAAGTTGG + Intronic
993080915 5:83299876-83299898 GAAACAAAAGCAACAAAAGTTGG - Intronic
993279169 5:85903597-85903619 GATAACAGAGCAACCCAGGTAGG + Intergenic
993601944 5:89937060-89937082 GATACAAAACAAACTCAATTTGG + Intergenic
994480479 5:100328082-100328104 TATACAAAATCAACTCAAGGGGG - Intergenic
995158041 5:108939395-108939417 TATACAATAGTTACCCAAGTTGG + Intronic
996678747 5:126207032-126207054 TATACAAAATCAACTCAAGATGG + Intergenic
997838199 5:137213807-137213829 TATACAACAGCAACCCCAGATGG - Intronic
998999090 5:147900220-147900242 GTTGCAAAAGCAACCACAGTAGG + Intronic
1001851091 5:174966410-174966432 GAAATAAAAGCCACCCAAATAGG - Intergenic
1002029839 5:176419677-176419699 GAAATAAAAGCAACCCAGATTGG - Intergenic
1004680684 6:17891495-17891517 GGAACAAAAGAAACCCAACTGGG + Intronic
1006872500 6:37264796-37264818 AATAGAAAAGCATTCCAAGTAGG + Intronic
1009001464 6:57721628-57721650 GATACAAAAACTAGCCAAGTGGG - Intergenic
1009694637 6:67086457-67086479 TATACAAAATCAACTCAAGATGG - Intergenic
1012155094 6:95809489-95809511 TATACAAAACCAACTCAAGATGG - Intergenic
1013734234 6:113206915-113206937 GTCAAAAAAGGAACCCAAGTAGG + Intergenic
1013902039 6:115168484-115168506 GCCACAAAAGCAACTCATGTAGG + Intergenic
1014059660 6:117056478-117056500 TATACAAAATCAACTCAAGATGG - Intergenic
1016697289 6:147012033-147012055 GATACAAAAGGAACACAAATTGG + Intergenic
1017567406 6:155702260-155702282 GAAATAAAAGCCACCCAAATAGG - Intergenic
1017643743 6:156518876-156518898 TATACAAAAACAACCTAAGAGGG + Intergenic
1018514511 6:164563764-164563786 GTTACAAAATTAACACAAGTGGG - Intergenic
1020114272 7:5466870-5466892 GACACAAAAGCAAACTCAGTGGG + Intronic
1020528118 7:9290640-9290662 GATACAAAAGCAAAGAAAGATGG - Intergenic
1023142551 7:37116774-37116796 GATGCAAAAGCAGCCCATCTTGG - Intronic
1026485414 7:70815649-70815671 GAAATAAAAGCCACCCAAATTGG + Intergenic
1028140229 7:87265331-87265353 TATACAAAATCAACTCAAGATGG + Intergenic
1028880759 7:95877121-95877143 GATACAATAGCTCTCCAAGTGGG - Intronic
1029883676 7:103844155-103844177 GATACAAATCCAAGCCATGTAGG + Intronic
1030531181 7:110713065-110713087 TATACAAAATCAACTCAAGATGG - Intronic
1032158791 7:129493767-129493789 GATACAATAGCTCACCAAGTTGG - Intergenic
1035136379 7:156707855-156707877 GAAACAAAAGGCACCCAAATTGG + Intronic
1035706050 8:1675810-1675832 AAAACAAAACCAAACCAAGTAGG - Intronic
1035850148 8:2910915-2910937 GATATAAAAGCAAAGCAAGAAGG + Intergenic
1037048421 8:14338373-14338395 GTTACATAAGCTACCCACGTGGG - Intronic
1037478545 8:19281466-19281488 TATACAAAATCAACTCAAGATGG - Intergenic
1038708339 8:29918051-29918073 CATACAAAAGTAACTCAAGATGG + Intergenic
1038867005 8:31449862-31449884 GACATAAAAGGAACCCAAATAGG + Intergenic
1039603918 8:38865467-38865489 TAAACAAAAGCAACCCTTGTGGG - Intergenic
1041554471 8:59137244-59137266 GTTACAGAAACAAACCAAGTAGG + Intergenic
1041556295 8:59160023-59160045 GTTACAAAAGACACCCATGTTGG - Intergenic
1043650058 8:82579494-82579516 GGCACACAAGCAACCCAACTAGG + Intergenic
1043671951 8:82897380-82897402 TATACAAAATCAACTCAAGATGG - Intergenic
1046312269 8:112453285-112453307 GAAATAAAAGGAATCCAAGTAGG + Intronic
1046524366 8:115365461-115365483 TATACAAAATCAACTCAAGATGG - Intergenic
1046796058 8:118373411-118373433 GATACTTCAGCAACTCAAGTAGG - Intronic
1050186173 9:2976642-2976664 GAAACAAAAGACATCCAAGTTGG + Intergenic
1051395321 9:16614173-16614195 AATACAAAAGCAACAGACGTAGG + Intronic
1053045397 9:34911932-34911954 GATCCAAAGGCAACCTGAGTCGG + Intergenic
1053636255 9:40007959-40007981 GAAACAAAAGCCATCCAAATAGG + Intergenic
1053769737 9:41456689-41456711 GAAACAAAAGCCATCCAAATAGG - Intergenic
1054548405 9:66368168-66368190 GAAACAAAAGCCATCCAAATGGG - Intergenic
1054884473 9:70181008-70181030 TATACAAAATTAACTCAAGTTGG - Intronic
1054945476 9:70791939-70791961 GATAGAAAAGCAAAGCAAGAAGG - Intronic
1056555153 9:87682017-87682039 GATCCAATAGCAGCCCAAGAAGG + Intronic
1056748707 9:89328790-89328812 GATACAGAAGCAACCCAAGTGGG + Exonic
1058156318 9:101519876-101519898 CATACAAAATCAACCCAAGATGG - Intronic
1058277380 9:103061152-103061174 GAAATAAAAGCCACCCAAATTGG - Intergenic
1058962928 9:110008711-110008733 GAGACACAAGCAACCCACCTTGG - Intronic
1059116342 9:111603294-111603316 GAAACAAAAACAAACCAAGCTGG - Intergenic
1060327360 9:122630144-122630166 GAAAGAAAAGCCACCCAAATTGG + Intergenic
1060539401 9:124419615-124419637 GATACCAAAGAAACCCAGGTAGG - Intergenic
1060662414 9:125412040-125412062 GAGACACAAGCAGCCCCAGTGGG - Intergenic
1062051500 9:134449623-134449645 TATACTAAAGATACCCAAGTAGG - Intergenic
1186071520 X:5826238-5826260 GTTACAATAGCATCCCCAGTTGG - Intergenic
1186967934 X:14808872-14808894 GATACAAAATCAACAAAAATCGG + Intergenic
1188701825 X:33274031-33274053 AATACAAAACAAACACAAGTAGG + Intronic
1191031109 X:55973190-55973212 TATACAAAATCAACTCAAGATGG + Intergenic
1191888510 X:65915724-65915746 TATACAAAATCAACTCAAGAGGG - Intergenic
1192061754 X:67834898-67834920 TATAAAAAAGCAACTCAAGATGG + Intergenic
1193308932 X:79982135-79982157 TATACAAAAACAACTCAAGATGG - Intergenic
1193440088 X:81529920-81529942 TATACAAAATCAACTCAAGATGG - Intergenic
1193625586 X:83816451-83816473 TATACAAAATCAACTCAAGATGG - Intergenic
1194028053 X:88778562-88778584 TATACAAAATCAACTCAAGATGG - Intergenic
1194030726 X:88810310-88810332 TATACAAAAGCAACTCAAGATGG - Intergenic
1194036222 X:88875865-88875887 TATACAAAATCAACTCAAGATGG - Intergenic
1194888040 X:99342680-99342702 AATATAAACGCAATCCAAGTTGG - Intergenic
1195492208 X:105484156-105484178 GATAGAGTAACAACCCAAGTAGG + Intronic
1196174650 X:112627558-112627580 GACACAAAAGCATGCCAATTGGG + Intergenic
1196577798 X:117340337-117340359 TATACAAAAGTAACTCAAGATGG + Intergenic
1197642118 X:128978263-128978285 TATACAAAATCAACTCAAGATGG + Intergenic
1198315195 X:135458790-135458812 GAAATAAAAGGCACCCAAGTTGG - Intergenic
1198799709 X:140436314-140436336 GATAGAAAGGGGACCCAAGTAGG + Intergenic
1199644235 X:149890210-149890232 GATACAAAAGGCATCCAAATAGG + Intergenic
1199668961 X:150125832-150125854 TATACAAAATCAACTCAAGATGG + Intergenic
1199882684 X:151987308-151987330 GATACAGAAGCAAGCAAAGCAGG + Intergenic
1201517275 Y:14831941-14831963 GAAACAAAAGCATCCTAAATAGG + Intronic