ID: 1159391302

View in Genome Browser
Species Human (GRCh38)
Location 18:67796041-67796063
Sequence AAGGAGAATGAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159391302_1159391309 11 Left 1159391302 18:67796041-67796063 CCATTCTCATTCTCATTCTCCTT No data
Right 1159391309 18:67796075-67796097 CTCCAGCTTGTTTTGCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159391302 Original CRISPR AAGGAGAATGAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr