ID: 1159393089

View in Genome Browser
Species Human (GRCh38)
Location 18:67820454-67820476
Sequence ACTGGGTCTTAGAATTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159393089_1159393090 -9 Left 1159393089 18:67820454-67820476 CCATTCAAATTCTAAGACCCAGT No data
Right 1159393090 18:67820468-67820490 AGACCCAGTTGCTGCTCCTTCGG No data
1159393089_1159393091 -8 Left 1159393089 18:67820454-67820476 CCATTCAAATTCTAAGACCCAGT No data
Right 1159393091 18:67820469-67820491 GACCCAGTTGCTGCTCCTTCGGG No data
1159393089_1159393094 4 Left 1159393089 18:67820454-67820476 CCATTCAAATTCTAAGACCCAGT No data
Right 1159393094 18:67820481-67820503 GCTCCTTCGGGTTGCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159393089 Original CRISPR ACTGGGTCTTAGAATTTGAA TGG (reversed) Intergenic
No off target data available for this crispr