ID: 1159393091

View in Genome Browser
Species Human (GRCh38)
Location 18:67820469-67820491
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159393089_1159393091 -8 Left 1159393089 18:67820454-67820476 CCATTCAAATTCTAAGACCCAGT No data
Right 1159393091 18:67820469-67820491 GACCCAGTTGCTGCTCCTTCGGG No data
1159393087_1159393091 29 Left 1159393087 18:67820417-67820439 CCTTTCAAATCAGCTAGTGGGGG No data
Right 1159393091 18:67820469-67820491 GACCCAGTTGCTGCTCCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159393091 Original CRISPR GACCCAGTTGCTGCTCCTTC GGG Intergenic