ID: 1159393091 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:67820469-67820491 |
Sequence | GACCCAGTTGCTGCTCCTTC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1159393089_1159393091 | -8 | Left | 1159393089 | 18:67820454-67820476 | CCATTCAAATTCTAAGACCCAGT | No data | ||
Right | 1159393091 | 18:67820469-67820491 | GACCCAGTTGCTGCTCCTTCGGG | No data | ||||
1159393087_1159393091 | 29 | Left | 1159393087 | 18:67820417-67820439 | CCTTTCAAATCAGCTAGTGGGGG | No data | ||
Right | 1159393091 | 18:67820469-67820491 | GACCCAGTTGCTGCTCCTTCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1159393091 | Original CRISPR | GACCCAGTTGCTGCTCCTTC GGG | Intergenic | ||