ID: 1159393094

View in Genome Browser
Species Human (GRCh38)
Location 18:67820481-67820503
Sequence GCTCCTTCGGGTTGCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159393089_1159393094 4 Left 1159393089 18:67820454-67820476 CCATTCAAATTCTAAGACCCAGT No data
Right 1159393094 18:67820481-67820503 GCTCCTTCGGGTTGCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159393094 Original CRISPR GCTCCTTCGGGTTGCTCTTC TGG Intergenic