ID: 1159396962

View in Genome Browser
Species Human (GRCh38)
Location 18:67871835-67871857
Sequence GTCTCAGCTGAATTTAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159396962_1159396965 -2 Left 1159396962 18:67871835-67871857 CCTTACCTAAATTCAGCTGAGAC No data
Right 1159396965 18:67871856-67871878 ACTTCGTTGTTACTACAGCTGGG No data
1159396962_1159396966 -1 Left 1159396962 18:67871835-67871857 CCTTACCTAAATTCAGCTGAGAC No data
Right 1159396966 18:67871857-67871879 CTTCGTTGTTACTACAGCTGGGG No data
1159396962_1159396967 0 Left 1159396962 18:67871835-67871857 CCTTACCTAAATTCAGCTGAGAC No data
Right 1159396967 18:67871858-67871880 TTCGTTGTTACTACAGCTGGGGG No data
1159396962_1159396964 -3 Left 1159396962 18:67871835-67871857 CCTTACCTAAATTCAGCTGAGAC No data
Right 1159396964 18:67871855-67871877 GACTTCGTTGTTACTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159396962 Original CRISPR GTCTCAGCTGAATTTAGGTA AGG (reversed) Intergenic
No off target data available for this crispr