ID: 1159396964

View in Genome Browser
Species Human (GRCh38)
Location 18:67871855-67871877
Sequence GACTTCGTTGTTACTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159396960_1159396964 19 Left 1159396960 18:67871813-67871835 CCAGCTTTATTTCCTGTCTGCTC No data
Right 1159396964 18:67871855-67871877 GACTTCGTTGTTACTACAGCTGG No data
1159396961_1159396964 7 Left 1159396961 18:67871825-67871847 CCTGTCTGCTCCTTACCTAAATT No data
Right 1159396964 18:67871855-67871877 GACTTCGTTGTTACTACAGCTGG No data
1159396963_1159396964 -8 Left 1159396963 18:67871840-67871862 CCTAAATTCAGCTGAGACTTCGT No data
Right 1159396964 18:67871855-67871877 GACTTCGTTGTTACTACAGCTGG No data
1159396962_1159396964 -3 Left 1159396962 18:67871835-67871857 CCTTACCTAAATTCAGCTGAGAC No data
Right 1159396964 18:67871855-67871877 GACTTCGTTGTTACTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159396964 Original CRISPR GACTTCGTTGTTACTACAGC TGG Intergenic
No off target data available for this crispr