ID: 1159398642

View in Genome Browser
Species Human (GRCh38)
Location 18:67900298-67900320
Sequence ATTTTCTCCTAGGAGTTTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159398642_1159398645 7 Left 1159398642 18:67900298-67900320 CCGTAAAACTCCTAGGAGAAAAT No data
Right 1159398645 18:67900328-67900350 AAGCTCCTTGACATTGATCTTGG 0: 3
1: 50
2: 215
3: 621
4: 1206
1159398642_1159398647 15 Left 1159398642 18:67900298-67900320 CCGTAAAACTCCTAGGAGAAAAT No data
Right 1159398647 18:67900336-67900358 TGACATTGATCTTGGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159398642 Original CRISPR ATTTTCTCCTAGGAGTTTTA CGG (reversed) Intergenic
No off target data available for this crispr