ID: 1159398645

View in Genome Browser
Species Human (GRCh38)
Location 18:67900328-67900350
Sequence AAGCTCCTTGACATTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2095
Summary {0: 3, 1: 50, 2: 215, 3: 621, 4: 1206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159398644_1159398645 -3 Left 1159398644 18:67900308-67900330 CCTAGGAGAAAATAGGTGAAAAG No data
Right 1159398645 18:67900328-67900350 AAGCTCCTTGACATTGATCTTGG 0: 3
1: 50
2: 215
3: 621
4: 1206
1159398642_1159398645 7 Left 1159398642 18:67900298-67900320 CCGTAAAACTCCTAGGAGAAAAT No data
Right 1159398645 18:67900328-67900350 AAGCTCCTTGACATTGATCTTGG 0: 3
1: 50
2: 215
3: 621
4: 1206
1159398640_1159398645 21 Left 1159398640 18:67900284-67900306 CCTAGGACTTGAATCCGTAAAAC No data
Right 1159398645 18:67900328-67900350 AAGCTCCTTGACATTGATCTTGG 0: 3
1: 50
2: 215
3: 621
4: 1206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159398645 Original CRISPR AAGCTCCTTGACATTGATCT TGG Intergenic
Too many off-targets to display for this crispr