ID: 1159398647

View in Genome Browser
Species Human (GRCh38)
Location 18:67900336-67900358
Sequence TGACATTGATCTTGGCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159398640_1159398647 29 Left 1159398640 18:67900284-67900306 CCTAGGACTTGAATCCGTAAAAC No data
Right 1159398647 18:67900336-67900358 TGACATTGATCTTGGCAATTTGG No data
1159398644_1159398647 5 Left 1159398644 18:67900308-67900330 CCTAGGAGAAAATAGGTGAAAAG No data
Right 1159398647 18:67900336-67900358 TGACATTGATCTTGGCAATTTGG No data
1159398642_1159398647 15 Left 1159398642 18:67900298-67900320 CCGTAAAACTCCTAGGAGAAAAT No data
Right 1159398647 18:67900336-67900358 TGACATTGATCTTGGCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159398647 Original CRISPR TGACATTGATCTTGGCAATT TGG Intergenic
No off target data available for this crispr