ID: 1159399438

View in Genome Browser
Species Human (GRCh38)
Location 18:67911578-67911600
Sequence CAGTATGTGCAGAAATTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159399438_1159399441 5 Left 1159399438 18:67911578-67911600 CCATGTAATTTCTGCACATACTG No data
Right 1159399441 18:67911606-67911628 TCTTTGCCTTCCACGGTGAGTGG No data
1159399438_1159399444 18 Left 1159399438 18:67911578-67911600 CCATGTAATTTCTGCACATACTG No data
Right 1159399444 18:67911619-67911641 CGGTGAGTGGAAGAATCCTGAGG No data
1159399438_1159399440 -2 Left 1159399438 18:67911578-67911600 CCATGTAATTTCTGCACATACTG No data
Right 1159399440 18:67911599-67911621 TGGCTACTCTTTGCCTTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159399438 Original CRISPR CAGTATGTGCAGAAATTACA TGG (reversed) Intergenic
No off target data available for this crispr