ID: 1159401796

View in Genome Browser
Species Human (GRCh38)
Location 18:67947153-67947175
Sequence TATTAGGCATATATGTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159401796_1159401800 -1 Left 1159401796 18:67947153-67947175 CCAATCCACATATATGCCTAATA No data
Right 1159401800 18:67947175-67947197 ATGGCACACTGAAATAAAGCTGG No data
1159401796_1159401801 0 Left 1159401796 18:67947153-67947175 CCAATCCACATATATGCCTAATA No data
Right 1159401801 18:67947176-67947198 TGGCACACTGAAATAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159401796 Original CRISPR TATTAGGCATATATGTGGAT TGG (reversed) Intergenic
No off target data available for this crispr