ID: 1159401800

View in Genome Browser
Species Human (GRCh38)
Location 18:67947175-67947197
Sequence ATGGCACACTGAAATAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159401796_1159401800 -1 Left 1159401796 18:67947153-67947175 CCAATCCACATATATGCCTAATA No data
Right 1159401800 18:67947175-67947197 ATGGCACACTGAAATAAAGCTGG No data
1159401798_1159401800 -6 Left 1159401798 18:67947158-67947180 CCACATATATGCCTAATATGGCA No data
Right 1159401800 18:67947175-67947197 ATGGCACACTGAAATAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159401800 Original CRISPR ATGGCACACTGAAATAAAGC TGG Intergenic
No off target data available for this crispr