ID: 1159428048

View in Genome Browser
Species Human (GRCh38)
Location 18:68314604-68314626
Sequence TGTGCAGAGAGTGGACACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159428048_1159428053 7 Left 1159428048 18:68314604-68314626 CCAGCGTGTCCACTCTCTGCACA No data
Right 1159428053 18:68314634-68314656 CCCATTAGTTACTTTGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159428048 Original CRISPR TGTGCAGAGAGTGGACACGC TGG (reversed) Intergenic
No off target data available for this crispr