ID: 1159428049

View in Genome Browser
Species Human (GRCh38)
Location 18:68314613-68314635
Sequence GGTGGGTAGTGTGCAGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159428049_1159428056 28 Left 1159428049 18:68314613-68314635 CCACTCTCTGCACACTACCCACC No data
Right 1159428056 18:68314664-68314686 ATCAGATGACAAGTAAAAAGAGG No data
1159428049_1159428057 29 Left 1159428049 18:68314613-68314635 CCACTCTCTGCACACTACCCACC No data
Right 1159428057 18:68314665-68314687 TCAGATGACAAGTAAAAAGAGGG No data
1159428049_1159428053 -2 Left 1159428049 18:68314613-68314635 CCACTCTCTGCACACTACCCACC No data
Right 1159428053 18:68314634-68314656 CCCATTAGTTACTTTGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159428049 Original CRISPR GGTGGGTAGTGTGCAGAGAG TGG (reversed) Intergenic
No off target data available for this crispr