ID: 1159428053

View in Genome Browser
Species Human (GRCh38)
Location 18:68314634-68314656
Sequence CCCATTAGTTACTTTGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159428048_1159428053 7 Left 1159428048 18:68314604-68314626 CCAGCGTGTCCACTCTCTGCACA No data
Right 1159428053 18:68314634-68314656 CCCATTAGTTACTTTGAAGCCGG No data
1159428049_1159428053 -2 Left 1159428049 18:68314613-68314635 CCACTCTCTGCACACTACCCACC No data
Right 1159428053 18:68314634-68314656 CCCATTAGTTACTTTGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159428053 Original CRISPR CCCATTAGTTACTTTGAAGC CGG Intergenic
No off target data available for this crispr