ID: 1159428858

View in Genome Browser
Species Human (GRCh38)
Location 18:68325084-68325106
Sequence TAATGTTCAGTGATTTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159428858_1159428864 23 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428864 18:68325130-68325152 AGGGAGAAAACAGATGGGCTAGG No data
1159428858_1159428865 24 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG No data
1159428858_1159428861 4 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428861 18:68325111-68325133 AAATACTACGAAAGGTAGAAGGG No data
1159428858_1159428860 3 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428860 18:68325110-68325132 AAAATACTACGAAAGGTAGAAGG No data
1159428858_1159428863 18 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428863 18:68325125-68325147 GTAGAAGGGAGAAAACAGATGGG No data
1159428858_1159428859 -4 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428859 18:68325103-68325125 ATTATATAAAATACTACGAAAGG No data
1159428858_1159428862 17 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428862 18:68325124-68325146 GGTAGAAGGGAGAAAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159428858 Original CRISPR TAATGTTCAGTGATTTTAGC TGG (reversed) Intergenic
No off target data available for this crispr