ID: 1159428865

View in Genome Browser
Species Human (GRCh38)
Location 18:68325131-68325153
Sequence GGGAGAAAACAGATGGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159428858_1159428865 24 Left 1159428858 18:68325084-68325106 CCAGCTAAAATCACTGAACATTA No data
Right 1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159428865 Original CRISPR GGGAGAAAACAGATGGGCTA GGG Intergenic
No off target data available for this crispr