ID: 1159435414

View in Genome Browser
Species Human (GRCh38)
Location 18:68410549-68410571
Sequence TTGCATTTGCATATAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159435414_1159435416 26 Left 1159435414 18:68410549-68410571 CCATGCACTATATGCAAATGCAA No data
Right 1159435416 18:68410598-68410620 ACTTCGTTTTGAAAAGTAAGTGG No data
1159435414_1159435417 29 Left 1159435414 18:68410549-68410571 CCATGCACTATATGCAAATGCAA No data
Right 1159435417 18:68410601-68410623 TCGTTTTGAAAAGTAAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159435414 Original CRISPR TTGCATTTGCATATAGTGCA TGG (reversed) Intergenic
No off target data available for this crispr