ID: 1159437970

View in Genome Browser
Species Human (GRCh38)
Location 18:68442949-68442971
Sequence GTGTCTTTATAGCAGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159437969_1159437970 0 Left 1159437969 18:68442926-68442948 CCACAATAAACATACGTGTGCAT 0: 8895
1: 7838
2: 3340
3: 1032
4: 582
Right 1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG No data
1159437968_1159437970 26 Left 1159437968 18:68442900-68442922 CCAAGTCTTTGCTATTGTGAATA 0: 19187
1: 12795
2: 9679
3: 8399
4: 8831
Right 1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159437970 Original CRISPR GTGTCTTTATAGCAGCATGA TGG Intergenic
No off target data available for this crispr