ID: 1159443244

View in Genome Browser
Species Human (GRCh38)
Location 18:68508486-68508508
Sequence GTGAGCACCCTGTTATCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159443243_1159443244 24 Left 1159443243 18:68508439-68508461 CCAGAACAAGCTCTTGTAGGAAA No data
Right 1159443244 18:68508486-68508508 GTGAGCACCCTGTTATCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159443244 Original CRISPR GTGAGCACCCTGTTATCTAA AGG Intergenic
No off target data available for this crispr