ID: 1159446191

View in Genome Browser
Species Human (GRCh38)
Location 18:68544484-68544506
Sequence ATGTGGCCACTGCTGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159446191_1159446199 24 Left 1159446191 18:68544484-68544506 CCCCCCATCAGCAGTGGCCACAT No data
Right 1159446199 18:68544531-68544553 TCAGGAGAGTGCAGTGATTGTGG No data
1159446191_1159446200 25 Left 1159446191 18:68544484-68544506 CCCCCCATCAGCAGTGGCCACAT No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446191_1159446198 6 Left 1159446191 18:68544484-68544506 CCCCCCATCAGCAGTGGCCACAT No data
Right 1159446198 18:68544513-68544535 GAGAGAGAATCTATGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159446191 Original CRISPR ATGTGGCCACTGCTGATGGG GGG (reversed) Intergenic
No off target data available for this crispr