ID: 1159446197

View in Genome Browser
Species Human (GRCh38)
Location 18:68544501-68544523
Sequence GATTCTCTCTCTGCACCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159446197_1159446201 27 Left 1159446197 18:68544501-68544523 CCACATGGTGCAGAGAGAGAATC No data
Right 1159446201 18:68544551-68544573 TGGGACTTCGCATTAGAACTCGG No data
1159446197_1159446199 7 Left 1159446197 18:68544501-68544523 CCACATGGTGCAGAGAGAGAATC No data
Right 1159446199 18:68544531-68544553 TCAGGAGAGTGCAGTGATTGTGG No data
1159446197_1159446200 8 Left 1159446197 18:68544501-68544523 CCACATGGTGCAGAGAGAGAATC No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159446197 Original CRISPR GATTCTCTCTCTGCACCATG TGG (reversed) Intergenic
No off target data available for this crispr