ID: 1159446200

View in Genome Browser
Species Human (GRCh38)
Location 18:68544532-68544554
Sequence CAGGAGAGTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159446197_1159446200 8 Left 1159446197 18:68544501-68544523 CCACATGGTGCAGAGAGAGAATC No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446196_1159446200 21 Left 1159446196 18:68544488-68544510 CCATCAGCAGTGGCCACATGGTG No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446190_1159446200 29 Left 1159446190 18:68544480-68544502 CCTGCCCCCCATCAGCAGTGGCC No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446189_1159446200 30 Left 1159446189 18:68544479-68544501 CCCTGCCCCCCATCAGCAGTGGC No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446192_1159446200 24 Left 1159446192 18:68544485-68544507 CCCCCATCAGCAGTGGCCACATG No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446191_1159446200 25 Left 1159446191 18:68544484-68544506 CCCCCCATCAGCAGTGGCCACAT No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446195_1159446200 22 Left 1159446195 18:68544487-68544509 CCCATCAGCAGTGGCCACATGGT No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data
1159446193_1159446200 23 Left 1159446193 18:68544486-68544508 CCCCATCAGCAGTGGCCACATGG No data
Right 1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159446200 Original CRISPR CAGGAGAGTGCAGTGATTGT GGG Intergenic
No off target data available for this crispr