ID: 1159449603

View in Genome Browser
Species Human (GRCh38)
Location 18:68583534-68583556
Sequence CAGGGTATGAAGGCTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159449603_1159449615 25 Left 1159449603 18:68583534-68583556 CCACCAAAAGCCTTCATACCCTG No data
Right 1159449615 18:68583582-68583604 CATGAATTGAAACTGTGGTCAGG No data
1159449603_1159449610 -2 Left 1159449603 18:68583534-68583556 CCACCAAAAGCCTTCATACCCTG No data
Right 1159449610 18:68583555-68583577 TGGCCTCAGACACCCGGTAATGG No data
1159449603_1159449614 20 Left 1159449603 18:68583534-68583556 CCACCAAAAGCCTTCATACCCTG No data
Right 1159449614 18:68583577-68583599 GTGTGCATGAATTGAAACTGTGG No data
1159449603_1159449607 -8 Left 1159449603 18:68583534-68583556 CCACCAAAAGCCTTCATACCCTG No data
Right 1159449607 18:68583549-68583571 ATACCCTGGCCTCAGACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159449603 Original CRISPR CAGGGTATGAAGGCTTTTGG TGG (reversed) Intergenic
No off target data available for this crispr