ID: 1159451020

View in Genome Browser
Species Human (GRCh38)
Location 18:68601842-68601864
Sequence TGCCACCCTTTTCAAAGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159451018_1159451020 -7 Left 1159451018 18:68601826-68601848 CCCTACTGAGTGGTCTTGCCACC No data
Right 1159451020 18:68601842-68601864 TGCCACCCTTTTCAAAGATCAGG No data
1159451017_1159451020 -2 Left 1159451017 18:68601821-68601843 CCTTTCCCTACTGAGTGGTCTTG No data
Right 1159451020 18:68601842-68601864 TGCCACCCTTTTCAAAGATCAGG No data
1159451019_1159451020 -8 Left 1159451019 18:68601827-68601849 CCTACTGAGTGGTCTTGCCACCC No data
Right 1159451020 18:68601842-68601864 TGCCACCCTTTTCAAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159451020 Original CRISPR TGCCACCCTTTTCAAAGATC AGG Intergenic
No off target data available for this crispr