ID: 1159460796

View in Genome Browser
Species Human (GRCh38)
Location 18:68720603-68720625
Sequence CACTCTCCCAGCAAGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159460796 Original CRISPR CACTCTCCCAGCAAGGAGTC TGG (reversed) Intronic
900558031 1:3289824-3289846 CCCGCTCCCACCCAGGAGTCAGG + Intronic
901012920 1:6211248-6211270 CACCCTCCCAGCAGGGTGTCTGG + Intronic
901427649 1:9192785-9192807 CCCTCTTCCAGCCAGGACTCTGG - Intergenic
901436672 1:9250868-9250890 CACTCACCCAGCATGGAGGATGG - Intronic
901539657 1:9907668-9907690 CCCTCTCCAATCAAGGAGGCGGG + Intronic
903519068 1:23933799-23933821 CACTCTCCCAGTCACAAGTCTGG + Intergenic
904770457 1:32878374-32878396 CAGTCTCCCAGCAGTGATTCAGG + Intergenic
904834403 1:33325461-33325483 CACTCACACGGCAAGGAGGCCGG - Intronic
905440982 1:37996528-37996550 CCCTCTGCCAGCAGGGAGGCAGG + Intergenic
907722280 1:56983346-56983368 GCCTTGCCCAGCAAGGAGTCAGG + Intergenic
907722696 1:56986878-56986900 GCCTTGCCCAGCAAGGAGTCAGG - Intergenic
908625381 1:66034900-66034922 CACACTTCCATCAAGGACTCGGG - Intronic
911233719 1:95387043-95387065 CACTCTGCCATCACAGAGTCAGG + Intergenic
911789637 1:101997014-101997036 CATTCTCAGAGCTAGGAGTCCGG + Exonic
912147851 1:106816439-106816461 AACTCTGCCAGCAAGGAATCTGG + Intergenic
914687832 1:149997521-149997543 CACTCTCCCTGCAAGAAGGTAGG - Intronic
919243510 1:194946494-194946516 CCCTTTCCCATGAAGGAGTCTGG - Intergenic
920717834 1:208357704-208357726 CAGTCTCCCAGCACTGAGTGGGG - Intergenic
920917420 1:210269091-210269113 CACTCTTCCACCAAGAAGTAGGG - Intergenic
1062768236 10:81184-81206 CACTCCCCCAGCACAGGGTCTGG + Intergenic
1063210446 10:3876061-3876083 CACTACCTCAGCCAGGAGTCAGG - Intergenic
1065526048 10:26622430-26622452 CAGTCTCCCTGCACGGATTCTGG + Intergenic
1065767271 10:29041621-29041643 CACTCTCCCAGGAAGATGGCAGG - Intergenic
1067462883 10:46470968-46470990 AACTCTCTCAGAAAGGATTCAGG - Intergenic
1067624311 10:47913670-47913692 AACTCTCTCAGAAAGGATTCAGG + Intergenic
1074032300 10:109700972-109700994 CAGTCTCCCATTAAGGAGTGAGG - Intergenic
1080204136 11:29709565-29709587 CACTCGGCAAGCAAGGAGTTGGG - Intergenic
1080840499 11:35979234-35979256 CACTGTCCCATCTAGGAGCCCGG - Intronic
1085231920 11:74979533-74979555 CACTATTCCAGGAAGGAGTATGG + Intergenic
1085595548 11:77805898-77805920 CACTCTCCAAGCCAGAAGTCTGG + Intronic
1085795698 11:79537586-79537608 CGCACTCCCAGCAAGAAGCCCGG - Intergenic
1089270465 11:117298487-117298509 AATTCTCCCAGGAAGCAGTCTGG + Intronic
1096868043 12:54576800-54576822 CACTCCCAAATCAAGGAGTCCGG - Intronic
1096884196 12:54700106-54700128 CTCTCTCCCACCATGGAGCCTGG - Intergenic
1110305746 13:73984888-73984910 CACTCTCCCATCAAGGGGTGGGG + Intronic
1111672666 13:91348707-91348729 CACACTCCCAGCAAGCGGCCGGG - Intergenic
1112771612 13:102799749-102799771 CGCTCTCCCGGGAAGGAGTAGGG + Intronic
1113692016 13:112317804-112317826 CATTCTCTCAGCATGGAGCCAGG + Intergenic
1114527250 14:23374297-23374319 CAGACTCCCAGCAAGGGGTCTGG - Intronic
1114646011 14:24256504-24256526 CGCTCTCCCAGCCAGCAGGCAGG - Intronic
1117727911 14:58692465-58692487 CTCTCTCCCATGCAGGAGTCAGG + Intergenic
1118234334 14:63987326-63987348 CACTCTCCCTGCATTGAGTAAGG - Intronic
1119582914 14:75803769-75803791 CTCCCTTCCAGCATGGAGTCAGG - Intronic
1121932914 14:97989714-97989736 CACTTTCACAGCAAAGGGTCAGG - Intergenic
1122824073 14:104361173-104361195 CACTCCCCCAGGAATGAGTCAGG - Intergenic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1126103350 15:45132958-45132980 CACTCACTCAGCAGAGAGTCAGG - Intronic
1126691478 15:51292312-51292334 CTCACTACCAGCAAGGAGTTGGG - Intronic
1128790342 15:70428712-70428734 CACTGTCCCAGTATAGAGTCAGG + Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1130693513 15:86106885-86106907 CACACTGCCAGCAGGGAGTTAGG - Intergenic
1132203822 15:99973068-99973090 CACCCTACCTGCAAGGAGGCCGG - Exonic
1132875287 16:2134438-2134460 CACTGTCCCGGCGAGGAGCCTGG + Intronic
1134519701 16:14912952-14912974 CACTGTCCCGGCGAGGAGCCTGG - Intronic
1134554231 16:15153283-15153305 CACTGTCCCGGCGAGGAGCCTGG + Intergenic
1134568467 16:15271298-15271320 CACCCTCCCAGCCAGGTGTGTGG - Intergenic
1134707373 16:16311608-16311630 CACTGTCCCGGCGAGGAGCCTGG - Intergenic
1134933535 16:18227219-18227241 CACCCTCCCAGCCAGGTGTGTGG - Intergenic
1134960169 16:18400517-18400539 CACTGTCCCGGCGAGGAGCCTGG + Intergenic
1137401317 16:48156315-48156337 CATTCTCTCAGGAAGGAGCCTGG - Intergenic
1141575158 16:84958943-84958965 CCCCCTCCCAGGAAGGGGTCAGG + Intergenic
1143115670 17:4580598-4580620 CCCTCCACCAGGAAGGAGTCAGG - Intergenic
1145145394 17:20475513-20475535 CACGCTCCCATCATGGACTCTGG + Intergenic
1146526067 17:33567828-33567850 GAATCTCCCCTCAAGGAGTCTGG - Intronic
1146688694 17:34858216-34858238 GACTGGCCCAGCAAGGACTCTGG + Intergenic
1146744161 17:35313571-35313593 CACTGTCCCAGCAGGCCGTCTGG - Intergenic
1147168212 17:38604511-38604533 CGCTCTCCCAGGGAGGAGGCTGG - Intronic
1147979809 17:44267667-44267689 CCCTCTCCCACCTAGGAGGCAGG - Intronic
1149774490 17:59346510-59346532 CCCTCTCCAAGCAAGGAGGAAGG - Intronic
1151175488 17:72284504-72284526 GACTCTGCCAAAAAGGAGTCGGG + Intergenic
1152525162 17:80884304-80884326 CACTTTACGGGCAAGGAGTCAGG + Intronic
1152962020 18:85847-85869 CAGTCTCCCAGTGAGGTGTCTGG - Intergenic
1153812812 18:8766729-8766751 CCCTCTCCCAGGAAGGCGGCTGG - Intronic
1153917451 18:9758482-9758504 CACTAGCCCAGCAAAGAGACAGG - Intronic
1153978647 18:10291000-10291022 TCCTCTCCCAGCCATGAGTCAGG + Intergenic
1154162842 18:11992713-11992735 CACTCCACCAGCAATGAGTTAGG - Intronic
1155007699 18:21742543-21742565 CATTCACCCAGCAGTGAGTCAGG + Intronic
1156201256 18:34834730-34834752 CATTCTCACAGCAATGAGTGAGG - Intronic
1157007628 18:43604187-43604209 CACTCTCCCAAGACTGAGTCAGG - Intergenic
1158455645 18:57604908-57604930 CACTCTCCCAGCATGCACTTGGG - Intronic
1158654752 18:59320768-59320790 CAATCTTGCAGCAAGGAGTGGGG - Intergenic
1159460796 18:68720603-68720625 CACTCTCCCAGCAAGGAGTCTGG - Intronic
1163604098 19:18264816-18264838 CCCTCTCCCAGGGAGAAGTCTGG - Exonic
1163638100 19:18446739-18446761 AACACTCACAGCAAGTAGTCAGG + Exonic
1164577864 19:29416723-29416745 CACTGTGCCAGCAAGCAGGCTGG + Intergenic
1165638258 19:37362334-37362356 TACTCTCCCAAACAGGAGTCTGG - Exonic
1166747784 19:45149933-45149955 GCCTTTCCCAGCAATGAGTCAGG - Exonic
1168695189 19:58400254-58400276 CACTCTACCAGCTTGGAGCCAGG + Intergenic
926089850 2:10043135-10043157 CCCTCTCCCCGCACCGAGTCCGG + Intronic
926862351 2:17322324-17322346 CACTCTCCCAGCTTGGCCTCAGG + Intergenic
927322951 2:21769769-21769791 CTGTCTCCCAGCAAGCACTCTGG + Intergenic
929536331 2:42786699-42786721 CACGCTCCAAGAAAGGAGTGAGG + Intronic
929856185 2:45640315-45640337 CCCACTCCCAGGAAAGAGTCGGG + Intergenic
932334238 2:70920803-70920825 CTCTGTCCCAGCCAGGATTCTGG - Intronic
932895758 2:75637914-75637936 CAAATTCCCAGGAAGGAGTCCGG + Intergenic
933996661 2:87675090-87675112 CAGGCTCCAAGCAAGAAGTCAGG - Intergenic
936297190 2:111275820-111275842 CAGGCTCCAAGCAAGAAGTCAGG + Intergenic
937515985 2:122656006-122656028 CAATCTTCCAGCAAGGAGGAGGG - Intergenic
937992218 2:127670838-127670860 CAGCCTCCCAGCGAGGAGTCTGG - Intronic
938069414 2:128300545-128300567 CCCTCTCCCAGCAAGTAGGGAGG + Intronic
940877337 2:158911138-158911160 CACTCTGTCACCCAGGAGTCTGG + Intergenic
942088493 2:172464780-172464802 CAGTCTCCCACAAAGGATTCAGG - Intronic
942780514 2:179636268-179636290 GACTCTCCCAGCAAGGACAGTGG - Intronic
943203686 2:184861996-184862018 CAATCTTCCTGCAACGAGTCAGG - Intronic
948560966 2:238851427-238851449 CACCCTCCAAGCCAGGTGTCTGG - Intronic
948780713 2:240320086-240320108 GGCTCTCCCAGGACGGAGTCTGG - Intergenic
948856649 2:240733361-240733383 CCCTCTCCCTGCAGTGAGTCTGG - Intronic
1169240085 20:3969719-3969741 CACTATCCCAGCAAGATGGCTGG - Intronic
1170460930 20:16575681-16575703 CACCCTCCCTGCAAGGAGCCAGG + Intergenic
1170531299 20:17295298-17295320 CACTTCCCAAGCAAGGAGACTGG + Intronic
1170550325 20:17470837-17470859 CACTCTGCAAGCAGGGAGTGGGG + Intronic
1170566810 20:17612236-17612258 CAGTCTCCCAGCCAGAAGCCAGG + Intergenic
1175258288 20:57659829-57659851 CACTCTCCCGGCAAGGTCACAGG + Intronic
1179840167 21:44067380-44067402 CACCCACCCAGCAGGGTGTCGGG - Intronic
1180093315 21:45543194-45543216 CACTCTCCCAGGAAGGCGTGGGG + Intronic
1180159365 21:45992231-45992253 CACTTCCCCAGGAAGGTGTCAGG - Intronic
1180160086 21:45995250-45995272 CACTTCCCCAGGAAGGTGTCGGG - Intronic
1181976074 22:26730913-26730935 TACTCTCCCAGCAGTCAGTCAGG + Intergenic
1183888220 22:40902830-40902852 CTGTCTCACAGCAAGGAGTCTGG + Intronic
1184768301 22:46583900-46583922 CACTCTGCCCTCAAGGAGGCAGG - Intronic
1185416150 22:50711677-50711699 CACTCCCCCAGACAGGGGTCAGG - Intergenic
950943397 3:16917815-16917837 CACTCCCCCACCAAGGAGTGGGG - Intronic
954453466 3:50584226-50584248 CACTGTCCTAGCCAGGACTCTGG - Exonic
956236734 3:67080167-67080189 AATTCTCCCAGCAACAAGTCAGG + Intergenic
956297862 3:67734285-67734307 CACTCTAAAAGCAAGGAATCTGG - Intergenic
957028219 3:75209241-75209263 CACTCTCCCAGCACGTAGGTGGG - Intergenic
958670720 3:97200258-97200280 CACTGACCCAGGAAGGAGCCTGG - Intronic
960955210 3:123026818-123026840 CACCCTCCCAGCCGGGAGTGCGG + Intronic
961353779 3:126321222-126321244 CCCTTTCCCAGCAAGGGGCCAGG + Intergenic
963264019 3:143221293-143221315 CTACCTCCCAGCAAGGGGTCTGG + Intergenic
964453607 3:156836928-156836950 TAGTCTTCCAGGAAGGAGTCTGG + Intronic
965331396 3:167379224-167379246 CTCTCTCCCTGCCAGGTGTCAGG + Intronic
965462628 3:168986388-168986410 CATTCCACCAGCAAGGATTCAGG - Intergenic
965486669 3:169286536-169286558 AACGCTCCCTGCAAGGAATCAGG + Intronic
965776825 3:172240409-172240431 CCCTCTACCAGAAAGGAGTTAGG - Intronic
966775211 3:183537647-183537669 GAATCTCCCAGCATGAAGTCAGG + Intronic
966851563 3:184168091-184168113 CCCACTCCCAGCCAGGAGACAGG - Intronic
968469524 4:772964-772986 TAATCTCCCAGCAAGAGGTCAGG - Intergenic
968867727 4:3224578-3224600 CACTCTCCCACCAAGCCTTCCGG + Intronic
970635501 4:18005473-18005495 CAGTGTCCCAGCAGGGACTCTGG + Intronic
972326949 4:38025830-38025852 CACTCTTTCAGCAAGCTGTCAGG - Intronic
975681114 4:76877187-76877209 CATAACCCCAGCAAGGAGTCGGG + Intergenic
980102122 4:128552228-128552250 CATTCAGCCAGCATGGAGTCTGG - Intergenic
982213419 4:153059615-153059637 TCCTCTCCCAGGAAGGAGTGAGG - Intergenic
984598653 4:181701186-181701208 CACTCTCCCACCAAGGAGACTGG + Intergenic
984842952 4:184084991-184085013 CAGTTTCCCAGTAATGAGTCAGG - Intergenic
986169990 5:5307377-5307399 CACTCTCCCAGCCAAGAGATGGG - Intronic
986354056 5:6906656-6906678 CACACTGCCAGCAAGGTGTAGGG + Intergenic
986726556 5:10602261-10602283 CAGGCTCCCAGCCAGGAGCCTGG + Intronic
988613002 5:32745523-32745545 CACTGACCCAGGCAGGAGTCAGG - Intronic
989354386 5:40526237-40526259 TAATCTACCAGCAAGGAGTGGGG + Intergenic
990533746 5:56699696-56699718 CAATTTCCCAGCAAGGTTTCGGG + Intergenic
999596359 5:153209761-153209783 GATTCTCCCAGCAAGGGGGCTGG - Intergenic
1001240275 5:170063642-170063664 CATTCTTCCTGCAAGGAGTTTGG + Intronic
1002076852 5:176713426-176713448 CCCTCTCACAGCAAGGAGGTGGG + Intergenic
1002288047 5:178178451-178178473 CACTTTCCCTGGGAGGAGTCTGG + Intergenic
1003033605 6:2623697-2623719 CACTCTGCCAGCCAGGAGCCAGG - Exonic
1003495219 6:6657797-6657819 AAGTCTACCAGCAAGGAGACAGG - Intergenic
1003573458 6:7271132-7271154 CACTCTCCCAGCTGCCAGTCTGG - Intronic
1004275375 6:14231059-14231081 CACTCACCAAGCAAGGAGCCGGG - Intergenic
1004514619 6:16311989-16312011 CCATCTGCCAGCAAGGAGACAGG - Intronic
1005574228 6:27177283-27177305 GACCCTCCCACCAAGGAGGCCGG - Intergenic
1006737885 6:36287655-36287677 CTCTCTCCCAGCAACTAATCTGG - Intronic
1007249165 6:40483969-40483991 CCCTCTCCCTGCCAGGAGTGCGG + Intronic
1008885183 6:56424673-56424695 CCCTCCACCAGCCAGGAGTCAGG + Intergenic
1009289872 6:61868727-61868749 CCCTCCCCCACCAAGGAGTTGGG + Intronic
1011053234 6:83177346-83177368 AACTCTCCGAGCAAGTAGTGTGG + Intronic
1016569280 6:145494196-145494218 CACTCTCCCAAGATTGAGTCAGG - Intergenic
1016925181 6:149338126-149338148 AACTCTCCCAGCAAGGTCTGAGG + Intronic
1017723921 6:157263754-157263776 CACTTTCTCACCAAGAAGTCTGG + Intergenic
1018345923 6:162899355-162899377 CAGCCTCCCAGGAATGAGTCAGG + Intronic
1022866872 7:34430873-34430895 GATGCTCCCAGGAAGGAGTCAGG + Intergenic
1024054989 7:45654348-45654370 CACACTGCCAGCAAGGCATCTGG - Intronic
1033448196 7:141440102-141440124 CACCCTCCCAGGATGGAGTGTGG + Intronic
1035347581 7:158214444-158214466 CTCTCTCTAATCAAGGAGTCAGG + Intronic
1036502240 8:9324765-9324787 CACTCACCCGGCAAGGGCTCGGG - Intergenic
1037714650 8:21386874-21386896 CACTGTCCAAGCCAGGCGTCTGG + Intergenic
1037813910 8:22102097-22102119 CACTCCCCCAGCAAGGTGCCTGG - Intronic
1037930118 8:22874366-22874388 CATTCTCCCTGCATGGAGGCAGG - Intronic
1038780047 8:30562404-30562426 CAGGCTCCGAGGAAGGAGTCTGG - Intronic
1040392479 8:46961758-46961780 CACTCTGCCAGCCAGGATCCTGG - Intergenic
1041096422 8:54354942-54354964 CACTCTCCCAGAAAATAGGCCGG + Intergenic
1047585600 8:126268743-126268765 CAGTCTCCCAGGAGGGAGTTAGG + Intergenic
1049606992 8:143534403-143534425 CACTCTTCCTGGCAGGAGTCCGG + Intronic
1051669155 9:19493191-19493213 CACTTTCCCACCAAGTAGCCTGG - Intergenic
1053117928 9:35521778-35521800 CACACTCCCAGCATGCCGTCTGG + Intronic
1053152942 9:35754474-35754496 CACTTCCCCAGCAAGGAGGCAGG + Exonic
1055780167 9:79812259-79812281 CACTCTCTAAGCAAAGATTCTGG + Intergenic
1056190628 9:84180886-84180908 CAGTCTCCCACCAAGCAGTAAGG - Intergenic
1056954536 9:91071786-91071808 CACTCTCTCATCAAGGAGGCCGG - Intergenic
1057843138 9:98502293-98502315 CACTGTCCCATCAGGGAGGCTGG + Intronic
1058657107 9:107232868-107232890 CACTCAACCACCAAGGAGGCAGG + Intergenic
1060683440 9:125586131-125586153 TACTCTCCCAGGAAGGATTTAGG + Intronic
1062570011 9:137180652-137180674 CACACCCCCAGCCAGGAGTGGGG + Intronic
1062736123 9:138138270-138138292 CAGTCTCCCAGTGAGGTGTCTGG + Intergenic
1189338620 X:40187072-40187094 GACTGTCCCAGCAAGGGGTGAGG + Intergenic
1190533157 X:51400434-51400456 CAGTCTCCCAGGAAGGGCTCAGG - Intergenic
1190635034 X:52424973-52424995 CAGTCTTCCAGGAAGGAGCCAGG + Intergenic
1194349547 X:92808963-92808985 CTCTCTCCCAGCCAAGAGTCAGG + Intergenic
1195443383 X:104922122-104922144 CACTCTACCACCAAGGTGGCTGG - Intronic
1200657868 Y:5925564-5925586 CTCTCTCCCAGCCAAAAGTCAGG + Intergenic
1202232626 Y:22671639-22671661 GACTCTGCCAACAAGGAGTGGGG + Intergenic
1202310530 Y:23524519-23524541 GACTCTGCCAACAAGGAGTGGGG - Intergenic
1202560272 Y:26146075-26146097 GACTCTGCCAACAAGGAGTGGGG + Intergenic