ID: 1159460944

View in Genome Browser
Species Human (GRCh38)
Location 18:68722138-68722160
Sequence CTGGCTTTGAACGCTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159460942_1159460944 -9 Left 1159460942 18:68722124-68722146 CCGTAGTATTGTCTCTGGCTTTG 0: 1
1: 0
2: 1
3: 8
4: 186
Right 1159460944 18:68722138-68722160 CTGGCTTTGAACGCTGTTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159460944 Original CRISPR CTGGCTTTGAACGCTGTTGA GGG Intronic
902057594 1:13615177-13615199 CTAGCTTTGACTGTTGTTGAAGG + Intronic
907714726 1:56916278-56916300 CTTGCTTTGAACCAGGTTGATGG - Intronic
909089915 1:71212620-71212642 CAGGGTTTGAACTCTGGTGAAGG + Intergenic
914327124 1:146630040-146630062 CTGGCTTTGAACACAGAAGAAGG - Intergenic
915743359 1:158137177-158137199 CTGGCTTTGAAGACTGATGAAGG + Intergenic
918464609 1:184808499-184808521 CAGTCTTTGTAAGCTGTTGATGG + Intronic
921482969 1:215684700-215684722 CTGGCTTAGAATGAAGTTGATGG - Intronic
1064380774 10:14839072-14839094 CTGGCTGTGAAGCCAGTTGATGG + Intronic
1064968744 10:21041349-21041371 GTGGCTTTGCAAGCTTTTGATGG - Intronic
1068425581 10:56859349-56859371 CTGGCTTTGAAGTCAGCTGATGG - Intergenic
1069109642 10:64430097-64430119 GTGGCTTTGAATTTTGTTGAAGG - Intergenic
1069160027 10:65082363-65082385 CTGGCTTGGGACTGTGTTGAAGG + Intergenic
1069559293 10:69418297-69418319 CTGCCTTTGATCTCTGTTGGTGG + Intergenic
1072895803 10:99365530-99365552 CTGGCTGTGCATGCTGTTGGTGG + Intronic
1075527973 10:123202211-123202233 CTGGTTTTGAATCCTGTTGGAGG + Intergenic
1081844179 11:46226933-46226955 ATGCCTTTGAATGCTGCTGAGGG + Intergenic
1084211944 11:67628441-67628463 CTGGGTTTGAAGGCTGGGGAGGG + Intronic
1084489645 11:69471455-69471477 CTGGCCTTGTGCGCGGTTGAAGG - Intergenic
1085441151 11:76563963-76563985 CTGGCTAAGATCGTTGTTGAAGG - Intergenic
1086027561 11:82313026-82313048 GTGGCTTTGAAGACTGATGAAGG - Intergenic
1088082324 11:105933532-105933554 CTGCCTTTTAACACTGTTTAAGG - Intronic
1089356870 11:117859656-117859678 CTGGCTCTGAAGGCTTTTTAAGG - Intronic
1091560186 12:1606243-1606265 CTGGCTGTGAACTCTGTAGCTGG - Intronic
1094292238 12:28864531-28864553 GTGGCTTTAAAAGCTGTTGTAGG - Intergenic
1101841639 12:108331750-108331772 CTGGCTTTGAAGGCTGGGGAAGG + Intronic
1106898544 13:34331330-34331352 CTGGCTTTGTAAGCTGATGCAGG - Intergenic
1110817385 13:79876964-79876986 CTGGCTTTGAAGACAGTGGAAGG - Intergenic
1112873062 13:103998927-103998949 CTGGCTTTGAACTCTGGGGTTGG - Intergenic
1116988640 14:51248953-51248975 CTTGCTTTGAAGGCTTTTAAGGG + Intronic
1119653231 14:76398443-76398465 CTGCCTTTGAACTCTGATGGGGG - Intronic
1125094093 15:35831057-35831079 CTTGCTTTGTAACCTGTTGATGG + Intergenic
1127875803 15:63110391-63110413 CTGGCTTTGAAGGCAGATGAAGG + Intergenic
1129657197 15:77532097-77532119 CTGGCCTTGATCTCTGTTGCTGG + Intergenic
1129787637 15:78320172-78320194 CTGGCTTTGCCAGGTGTTGAGGG - Intergenic
1130426914 15:83810685-83810707 CTGGCTTTGAAGACTGAAGAAGG - Intronic
1134275939 16:12776200-12776222 CTGGCTTTGAAGGCAGAAGAAGG + Intronic
1134782167 16:16908002-16908024 CTGGCTTGGGACTCTTTTGAAGG + Intergenic
1138085537 16:54130460-54130482 TTGTCTTTGAATGCTGTTCATGG + Intergenic
1139580010 16:67867454-67867476 CTGCCCTTGAAGGCTGTGGAAGG + Intronic
1140006436 16:71080899-71080921 CTGGCTTTGAACACAGAAGAAGG + Intronic
1141578081 16:84977875-84977897 CTGGCTTTGCATGCTGTTATTGG - Intronic
1142551183 17:740891-740913 CTGACCTTTAAGGCTGTTGAAGG - Intronic
1145303822 17:21658993-21659015 CTGTATTTGAACTCTGTTGAAGG + Intergenic
1145346211 17:22042828-22042850 CTGTATTTGAACCCTGTTGAAGG - Intergenic
1149324776 17:55518851-55518873 CTGGATTTCATCGCTGTTCAAGG - Intergenic
1152258340 17:79253193-79253215 CTGGCTTTGGCAGCTCTTGAGGG - Intronic
1156290586 18:35746254-35746276 CTGGCTTTGAAGACAGATGAAGG - Intergenic
1156953946 18:42938505-42938527 CTGTCCTTTAAAGCTGTTGAAGG + Intronic
1159460944 18:68722138-68722160 CTGGCTTTGAACGCTGTTGAGGG + Intronic
1160201697 18:76801758-76801780 CTGGCTTTGAGAGCAGCTGAGGG + Intronic
1160917860 19:1506304-1506326 CGGGCCTGGAACACTGTTGAGGG + Exonic
1162414136 19:10524258-10524280 ATGGCTTTAAACGCTATAGATGG - Intergenic
1164453365 19:28385924-28385946 CTGGTTTTGAAGGCTGCTGCGGG - Intergenic
1165446710 19:35860708-35860730 GTGGCTTTCAGGGCTGTTGAGGG + Intronic
1165663226 19:37601178-37601200 CAGGCTTTGCATGCTGTTTAGGG + Intronic
1167095115 19:47371193-47371215 CTGGCTTTGATCGGAGGTGATGG + Intronic
928879101 2:36076967-36076989 CTGTCTTGGAATCCTGTTGATGG - Intergenic
932775459 2:74525647-74525669 CTGGCTGTGAACCCCTTTGATGG - Exonic
933123986 2:78580225-78580247 CTGGCTTTGACGTCTGGTGAGGG - Intergenic
933891058 2:86770335-86770357 GTGCCTTTGAAAGCTGGTGAAGG + Intronic
934880521 2:97972820-97972842 CTGGCTTTGAAGGCAGGGGAAGG + Intronic
935268939 2:101417064-101417086 CTGGCTTTTAGTGCTGGTGATGG - Intronic
936645599 2:114366254-114366276 GTGGCTTTGAACCCTGTGCAAGG - Intergenic
937538627 2:122922451-122922473 CTGGGTTTGAAGTCTGTTTATGG + Intergenic
941310654 2:163926544-163926566 CTGGCTTTGGAAGCTGATGGTGG + Intergenic
942737331 2:179129637-179129659 CTGGCATTGACAGCTGTTAACGG - Intronic
943456668 2:188116610-188116632 CTGGCTATCATCTCTGTTGAAGG + Intergenic
943839866 2:192565546-192565568 CTGGCTTTAAACACAGTGGATGG + Intergenic
946788656 2:223275740-223275762 CTGGCTTTGAAAGCTGGTGCTGG + Intergenic
1168898118 20:1337965-1337987 CTGGCTCTGAACGCAGCTGTGGG + Intronic
1171521351 20:25776638-25776660 CTGTATTTGAACCCTGTTGAAGG + Intronic
1171555460 20:26079233-26079255 CTGTATTTGAACCCTGTTGAAGG - Intergenic
1172950303 20:38719294-38719316 CTGGTTTTAAAGGCTGCTGAGGG + Intergenic
1175839225 20:62016096-62016118 CTGGCTTTGAAGGCTGTCCTTGG - Intronic
1176655181 21:9581751-9581773 CTGTATTTGAACCCTGTTGAAGG + Intergenic
1177233537 21:18355283-18355305 CTGGCTTTGAATGTGGTTGGTGG + Intronic
1178766098 21:35452275-35452297 CTGGCTTTGAAGACAGTAGAAGG - Intronic
954972412 3:54662464-54662486 CTGACTTTGAAGGCTGTGAAGGG + Intronic
960215762 3:115035258-115035280 TTGGCTTTTTACTCTGTTGATGG - Intronic
960457996 3:117897446-117897468 CTGGCTGTGAAAGCTCTAGATGG - Intergenic
962266977 3:133950783-133950805 CTAGCATTGAACAGTGTTGAGGG - Intronic
962363238 3:134759018-134759040 CTGGCTTTGAAAGCAGAAGAAGG + Intronic
966568564 3:181412422-181412444 CTGTATCTGAACTCTGTTGATGG - Intergenic
969588444 4:8107919-8107941 CTGGCTTTGAAGGCAGAGGAAGG + Intronic
971657765 4:29371224-29371246 CTGTCTTTGAAACCTGTTGAAGG - Intergenic
972225942 4:37012035-37012057 TTGGCCTTGTACGCTGTTGGCGG + Intergenic
977059927 4:92244833-92244855 CTGGCTTTGTACTTTGTTAATGG + Intergenic
977494749 4:97760942-97760964 CTGGCTTTGAAGACTGATGGGGG - Intronic
979403310 4:120277828-120277850 CTGGATTTGAACCATGTTGAAGG + Intergenic
989530591 5:42503516-42503538 ATGGCTTTGAAGACTGTTGGTGG + Intronic
993985842 5:94596040-94596062 CTGTCTTTTTACTCTGTTGATGG + Intronic
995017719 5:107330662-107330684 CTGTCTTTGAACCCTGCTGGTGG - Intergenic
996976032 5:129435842-129435864 CTGGCTTTGAAAGTGGTAGAAGG - Intergenic
997499970 5:134365875-134365897 TTGGCTTTGAAGGATGTGGAGGG - Intronic
998808188 5:145939103-145939125 CTGGCTATGAACCTTGTTGTGGG + Intronic
1001218632 5:169879504-169879526 CTGGCTTTGAATGGTAATGAGGG + Intronic
1003359186 6:5408094-5408116 CTGGATTTGCACCCTGTTGCAGG + Intronic
1005286774 6:24336033-24336055 CTGGATTTGGTTGCTGTTGATGG - Intronic
1007108376 6:39298616-39298638 CTGGCTTTGCAAACCGTTGATGG + Intergenic
1014130403 6:117824972-117824994 CTAGCTAAGAACGCTGATGATGG - Intergenic
1014294404 6:119601133-119601155 CTGACTTTGGAGGCTTTTGAGGG - Intergenic
1015057857 6:128925568-128925590 CTGGATGTGAATGGTGTTGATGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1018294935 6:162335751-162335773 CTGGCCTTGAACTGTGTAGAAGG - Intronic
1019741256 7:2675618-2675640 TTGGCTTTGAAAAATGTTGATGG + Intergenic
1020153993 7:5706730-5706752 CTGCCTTTTCACTCTGTTGATGG + Intronic
1020576949 7:9945580-9945602 ATGCCTTTGAATGCTGTTGATGG + Intergenic
1025281818 7:57631596-57631618 CTGTATTTGAACCCTGTTGAAGG + Intergenic
1025302911 7:57833921-57833943 CTGTATTTGAACCCTGTTGAAGG - Intergenic
1026648270 7:72192060-72192082 CTGGCTTTGAATGCGGAGGAAGG - Intronic
1027652935 7:80893286-80893308 ATGGATTTGAACAATGTTGATGG - Intronic
1030096783 7:105907671-105907693 CTGGGTTTGAACGCTGCTTAGGG - Intronic
1034952976 7:155313464-155313486 ATGGGTTTGAAAGCAGTTGATGG - Intergenic
1037025741 8:14034906-14034928 CTGGCCTTGAAGGCTGATTAAGG - Intergenic
1048712795 8:137231049-137231071 CAGGCTTTGAAAGCATTTGAGGG + Intergenic
1050417303 9:5431163-5431185 CTGGCTTTGAAGATTGTTTAAGG - Intronic
1052891573 9:33705060-33705082 CTGGCTTAGGACGCTTTTCAAGG + Intergenic
1056469838 9:86894669-86894691 CTGCCTTTGAACAGAGTTGAGGG + Intergenic
1058930584 9:109715045-109715067 CTGACTTTGGATGCTGTTGCAGG - Intronic
1059210040 9:112505288-112505310 CTGGCTTTGAATCCTGTTTCTGG + Intronic
1062307223 9:135914837-135914859 CTGGCTTTGAAGGCAGAGGAAGG + Intergenic
1203632903 Un_KI270750v1:85223-85245 CTGTATTTGAACCCTGTTGAAGG + Intergenic
1201613327 Y:15867443-15867465 CTGACTTAGAAGGCTATTGAAGG - Intergenic