ID: 1159467587

View in Genome Browser
Species Human (GRCh38)
Location 18:68804545-68804567
Sequence CAGAATGTGGGGCAGCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159467582_1159467587 27 Left 1159467582 18:68804495-68804517 CCTGAAGTCTCAGTGTTGGAGCG 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG 0: 1
1: 0
2: 1
3: 17
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159467587 Original CRISPR CAGAATGTGGGGCAGCTACC AGG Intronic
901202056 1:7472632-7472654 CAGAAAGTGGGACAGCTGCTGGG + Intronic
903237270 1:21958157-21958179 CAGAAGGTGGGGCAGCAAGAGGG - Intergenic
904382355 1:30119940-30119962 CAGGATGGGAGGCAGCTCCCAGG + Intergenic
912687800 1:111780536-111780558 GTGAATGGGGGGCTGCTACCTGG + Intronic
913475471 1:119232897-119232919 AAGAATTTGGGGCAGTTACCAGG - Intergenic
917709351 1:177668934-177668956 CTGCATGGAGGGCAGCTACCTGG + Intergenic
917930829 1:179821464-179821486 CAGAATGTGTGGCAGGTTCTGGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919750464 1:201034630-201034652 CAGAATGGGGAGGAGCTCCCTGG - Intergenic
919988092 1:202689771-202689793 CAGAATGTTGGGGAACTACCAGG - Intronic
922774561 1:228208755-228208777 CAGAGTGGGAGGCAGCTCCCAGG - Intronic
923217019 1:231857782-231857804 AAGAATGTGGACCGGCTACCCGG + Intronic
1071288884 10:84173916-84173938 CAGAAGGTAGGGCAGCCCCCAGG + Exonic
1071674998 10:87647252-87647274 CCCAATGTGGGGCAGTTGCCTGG + Intergenic
1074215696 10:111381638-111381660 CATCATGTAGGGCAGCTACCTGG + Intergenic
1074766342 10:116702617-116702639 CAGTGTGTGGAGCAGCTGCCTGG - Intronic
1076251568 10:128988076-128988098 CAGAAGGTGGGGCAGCAAGAGGG + Intergenic
1077167136 11:1148799-1148821 CAGACTGTGGGACAGGCACCTGG + Intergenic
1077283648 11:1756531-1756553 GAGAGTGTGGGGCAGTGACCAGG + Intronic
1077387424 11:2276835-2276857 CAGAAGGTGGGGGAGCCACAGGG - Intergenic
1077866524 11:6226123-6226145 CAAAATGTGGGGCTGGTGCCAGG - Intronic
1078435995 11:11326558-11326580 GAGAATGAAGGGCAGCTACCAGG - Intronic
1079081431 11:17415886-17415908 CGGAATGTGGGGGATCTGCCAGG + Intronic
1080210787 11:29782426-29782448 CAGATTGTAGGGGACCTACCAGG - Intergenic
1083169434 11:60914287-60914309 CGGAATGTGGGGCAGCGCACGGG + Intronic
1084703513 11:70802678-70802700 CAGGATTTGGGGCAGACACCTGG + Intronic
1084916727 11:72434262-72434284 CCGGACGTGGGGCAGCCACCGGG - Exonic
1085345157 11:75763903-75763925 CAGCATGTGGGGAAGCCACCAGG + Intronic
1088569422 11:111207228-111207250 AAGTATGTGGGGCTGCTTCCAGG - Intergenic
1089058684 11:115608379-115608401 CAGAATGGGGGTCAGCTGCTGGG + Intergenic
1090269106 11:125373547-125373569 CAGAATGTGGACCACCTGCCAGG - Intronic
1090890005 11:130915339-130915361 CAGGATGTGGGGCAGTCGCCCGG + Exonic
1091308202 11:134554298-134554320 CAGCCTGTGGGCCAGGTACCGGG - Intergenic
1092524352 12:9300739-9300761 CAGAAGCTGGGGCCGCTTCCTGG + Intergenic
1092542911 12:9431073-9431095 CAGAAGCTGGGGCCGCTTCCTGG - Intergenic
1094317042 12:29146356-29146378 AAGAATGGGGTGGAGCTACCAGG - Intergenic
1101654910 12:106711508-106711530 CATAATGGAGGACAGCTACCTGG - Exonic
1103398866 12:120628834-120628856 CAGAAAGTGGGGAAGCTATAAGG + Intergenic
1105272920 13:18894626-18894648 CAGGATGTGGGGCAGTAGCCTGG + Intergenic
1105594161 13:21820394-21820416 CAGAATGTGGGGCATTCTCCAGG - Intergenic
1106177362 13:27342681-27342703 CAGATGGTGGGCCAGGTACCAGG - Intergenic
1109062128 13:57632720-57632742 CAGCAAGTCGGGTAGCTACCGGG + Exonic
1112315973 13:98362295-98362317 CAGAATGGGGGGTAGCTGGCTGG - Intronic
1113674630 13:112198785-112198807 CAGAGGCTGGGGCAGCTCCCCGG + Intergenic
1116102805 14:40464098-40464120 CAGAATGGGGTGGAGCCACCGGG + Intergenic
1118303633 14:64636502-64636524 CAGGAAGTGGGGCAGCAAACTGG + Intergenic
1121870276 14:97400902-97400924 CAGAAGGTGTGGCATCTCCCAGG - Intergenic
1122095049 14:99364383-99364405 CAGGAAGTGGGGCTGATACCTGG + Intergenic
1122801359 14:104231244-104231266 CAGAATGTCAGGCACCCACCAGG - Intergenic
1124667783 15:31608892-31608914 CAGTATTTGGGGCATCTACCAGG - Intronic
1125191209 15:36996314-36996336 AAGAATGTGGGGCAGCTTTGGGG + Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1131177619 15:90219923-90219945 CAGAAAGAGGGGCAGTTCCCAGG - Intronic
1131985473 15:98039282-98039304 CAAAAAGTGGAGCAGCTACCGGG + Intergenic
1132873181 16:2124533-2124555 CTGGGTGTGGGGCAGCTCCCGGG + Intronic
1133116955 16:3582889-3582911 TAGCATGTGGGGCAGGAACCAGG + Intronic
1133433923 16:5763137-5763159 AAGAATGTGGGGCATCTGGCTGG + Intergenic
1134552268 16:15143712-15143734 CTGGGTGTGGGGCAGCTCCCGGG + Intergenic
1138545099 16:57713895-57713917 CAGCAAGTAGGTCAGCTACCTGG + Intronic
1138555058 16:57766108-57766130 CAGATAGTGGGGCAGCCACAGGG + Intronic
1139561976 16:67748878-67748900 CAGACACTGGGGAAGCTACCTGG - Intronic
1143115647 17:4580527-4580549 CACTGTGTGGGGCAGCTAGCCGG - Intergenic
1143378219 17:6479662-6479684 CAGAATCTGGGGCAGGTGACAGG + Intronic
1146133427 17:30297622-30297644 CATAGTGTGGGGCAGCTGCCAGG - Intergenic
1150336463 17:64334174-64334196 CAGACAGTGGGGGAGCTGCCTGG - Intronic
1151445254 17:74159511-74159533 CAGAATGTGGGGCAGCCCAGTGG + Intergenic
1158866097 18:61638960-61638982 CAGAGTGTGAGGCAGCTAGGAGG + Intergenic
1159467587 18:68804545-68804567 CAGAATGTGGGGCAGCTACCAGG + Intronic
1160732985 19:649601-649623 CAGGCAGTGGGGCAGCTCCCAGG + Intronic
1163561542 19:18022220-18022242 CAGAAAGTGGGGCAGGGAGCCGG - Intergenic
1165433786 19:35786208-35786230 CAGCCTGTGGGGCAGCCACAGGG + Intronic
1167300909 19:48676792-48676814 CGGAAACTGGGGCAGCCACCTGG + Intergenic
1168152170 19:54455111-54455133 CAGAGTGTGGGGCTGCGACGGGG - Intronic
927197843 2:20560295-20560317 CAGAACCTGGGGCAGCACCCAGG + Intergenic
930118977 2:47744333-47744355 CATCATGTGGGGCAGCTGCCTGG - Intronic
930732336 2:54740047-54740069 CAGAATGAGGAGCAGCTTCAGGG + Intronic
938072835 2:128317533-128317555 CAGAGGGTGGGGGAGCTGCCAGG - Intronic
938101954 2:128503631-128503653 CAGAAAGCGGGGCGGATACCAGG + Intergenic
940709515 2:157144649-157144671 CAGTATTTGGGGCACCTCCCGGG + Intergenic
944601998 2:201312861-201312883 CAGTATTTGGGGCATCTCCCGGG - Intronic
945061301 2:205911197-205911219 GAGAATGTGGTGGAGCTACAGGG + Intergenic
945691159 2:213037846-213037868 CAGAAAGTGGGCCAGGTGCCAGG + Intronic
946015830 2:216603166-216603188 CAGCATCTGTGGCAGCTCCCGGG + Intergenic
948530388 2:238600176-238600198 AAGAATGTGGCGCAGCCTCCTGG + Intergenic
1170127743 20:12984931-12984953 CTGGATGTGTGGCATCTACCTGG + Intergenic
1171255236 20:23685358-23685380 CAGCTTCTGGGGCAGCTGCCTGG + Intergenic
1172637537 20:36420111-36420133 CAGAAAGTGAGGCAGCTACAGGG - Intronic
1174528436 20:51191937-51191959 CACAATGTGGGGAGGCGACCAGG + Intergenic
1174555857 20:51394871-51394893 AGGAATGTGGGGCGGCTTCCAGG - Intronic
1174696659 20:52566109-52566131 CAGAATGAGGTGGAGCTAGCTGG + Intergenic
1176222237 20:63975216-63975238 CAGCATGTGGGGCAGCTGCCTGG - Exonic
1176809842 21:13526179-13526201 CAGGATGTGGGGCAGTAGCCCGG - Intergenic
1179266440 21:39807607-39807629 CAGAGTGTGGGGCAGCAGGCTGG + Intergenic
1180921050 22:19521848-19521870 TGGAATGTGTGGCAGCTTCCTGG - Intergenic
1181539116 22:23563964-23563986 CAGAATGTAAGGCAGCCAACAGG + Intergenic
1181549289 22:23627777-23627799 CAGAAACTGGGGCAGCCTCCAGG + Intronic
1181597237 22:23924015-23924037 CAGATTGTGGGGCATTTGCCTGG - Intergenic
1181799323 22:25334103-25334125 CAGAAGCTGGGGCAGCCTCCAGG - Intergenic
1182647411 22:31821543-31821565 CAGAATATGGCGGAGCTACAAGG + Exonic
1183038727 22:35160224-35160246 AAGGGTGTGGGGCAGTTACCTGG - Intergenic
950458685 3:13107957-13107979 CAGCATGCGGGGCTGCTCCCCGG - Intergenic
950963037 3:17125506-17125528 CACATTGTCGGGCAGATACCTGG + Intergenic
952129364 3:30342528-30342550 CAGAATCTGGCTCAGCTACCTGG - Intergenic
952178347 3:30891504-30891526 CAGAATATGGGCCAGTGACCTGG - Intronic
953931356 3:47007420-47007442 CAGAATGTAGGCCAGCTGCAGGG + Intronic
955051407 3:55414587-55414609 CAGAATTTGGCACAGCTCCCAGG + Intergenic
955981491 3:64531909-64531931 GAGAACGTGGGGCAGAAACCCGG - Intronic
958971085 3:100610865-100610887 CAGAAGGTTGGGGAGCTAGCAGG + Intronic
962367681 3:134796766-134796788 CGGAAAGTGGGGCTGCTAGCCGG - Intronic
962463772 3:135638378-135638400 CTGAAGGTGGGGCTGCTGCCAGG + Intergenic
964672773 3:159245025-159245047 CAGGATGTGGCCCAGCTTCCTGG - Intronic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
971727410 4:30331460-30331482 CATCATGTGGGGCAGCCATCCGG + Intergenic
978113975 4:104996947-104996969 GAAGAAGTGGGGCAGCTACCAGG - Intergenic
979038173 4:115752281-115752303 CAGAATGTGGTACAGCAAGCAGG - Intergenic
980701394 4:136436397-136436419 CAGAATATGCTGCAGCTATCAGG - Intergenic
982481504 4:155917495-155917517 CAGCATGTGGGGAAGCAACATGG - Intronic
984892252 4:184504473-184504495 CAGAAAGTGGGCCAGCAGCCGGG + Intergenic
985717093 5:1468811-1468833 CAGCCTGGGGGGCAGCTTCCTGG + Intronic
988913940 5:35873885-35873907 CAAAATGTATGGCAGCTTCCAGG - Intronic
994041380 5:95263459-95263481 TAGAATTTGTGGCAGCAACCTGG - Intronic
999474938 5:151889881-151889903 GAGAATGAGGTGCAGCTTCCTGG - Intronic
1001733109 5:173974479-173974501 CAGCATGCGGGGCTGCTAACAGG - Intronic
1002687363 5:181024263-181024285 CAGAAGGTGGGGCACCTCCTTGG - Intergenic
1003520123 6:6851191-6851213 GAGAATCTGGGACAGTTACCAGG - Intergenic
1003625790 6:7740126-7740148 CAGGATGATGGGCAGGTACCAGG + Intronic
1007307959 6:40921826-40921848 TAGAATGTGGGGAAGCTACAGGG + Intergenic
1007720947 6:43885169-43885191 CTGAGGGAGGGGCAGCTACCAGG + Intergenic
1008893189 6:56519749-56519771 CAGAAGGTGGGGGTGCTACCAGG - Intronic
1009920338 6:70051471-70051493 CTGAATATGTGGCACCTACCTGG - Intronic
1011088934 6:83572982-83573004 AAGAATGGAGGGCAGCTCCCTGG + Intronic
1015552854 6:134430325-134430347 CAGAATGTGGAGGTGCTACTAGG + Intergenic
1017273575 6:152538765-152538787 CAGATTGTGGGGCAACTACTGGG + Intronic
1018659116 6:166068602-166068624 CAGGCAGTGGGGCAGCCACCAGG - Intergenic
1018856505 6:167678882-167678904 GAGAAAGTGGTGCAGCTGCCTGG - Intergenic
1019324859 7:433016-433038 CAGAGTGTGGGGAACCTGCCTGG + Intergenic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1019663502 7:2239464-2239486 TAGACTGTGGGGCAGCTCCTGGG - Exonic
1020114788 7:5470386-5470408 CAGGAGCTGGGGCAGCTGCCCGG - Intronic
1023124514 7:36942185-36942207 CAGGTTGTGAAGCAGCTACCTGG - Intronic
1025025538 7:55513465-55513487 AAGAATGTGGGGAAGCTTCTCGG - Intronic
1025262114 7:57426408-57426430 CACAACGTGGGGCAGCGTCCTGG - Intergenic
1025925290 7:65954140-65954162 CAGAATGTAGGCCAGGTACAGGG - Exonic
1026473533 7:70714674-70714696 CAGAATGTGGGGCAGTCTTCAGG - Intronic
1029146132 7:98447415-98447437 CTGAATGTGGGGCTGGGACCTGG + Intergenic
1034718027 7:153261799-153261821 CAGAATTTGGCCCAGCTCCCTGG - Intergenic
1035355937 7:158276245-158276267 CAGAGTGTGGGGGTGCTACCAGG - Intronic
1037095839 8:14985746-14985768 CAGAATGTTCTTCAGCTACCTGG - Intronic
1041728031 8:61036383-61036405 CTGCAGGTGGGGCAGCAACCTGG + Intergenic
1042594985 8:70437395-70437417 CAGAATGTCTGACACCTACCAGG + Intergenic
1044445624 8:92272105-92272127 CAGCATGTTGGGCTGCCACCTGG + Intergenic
1045138333 8:99248951-99248973 CACAATGTTGTGCAACTACCAGG + Intronic
1048112597 8:131485040-131485062 CAGACTGAGTGGCAACTACCAGG + Intergenic
1049422639 8:142523754-142523776 GAGAATGTGGGGCTGCTTACTGG + Intronic
1051291688 9:15552214-15552236 CAGATTGTGAAGCAGCCACCGGG + Intergenic
1053587725 9:39477948-39477970 TAGAATGTGGGCCAGCCACATGG + Intergenic
1054578575 9:66887297-66887319 TAGAATGTGGGCCAGCCACATGG - Intronic
1058973131 9:110101247-110101269 CAGGATGTGGGGCTGCTCCTGGG + Intronic
1058979777 9:110158326-110158348 CAGAGTGTGGGGCACCCACTTGG - Intronic
1188004109 X:25005604-25005626 CAGGATGTGGGGCTGCTGGCAGG - Intronic
1188838457 X:34986914-34986936 CAGAATGAAGGGAAGCTATCCGG - Intergenic
1192344450 X:70289792-70289814 CAGAATGTGGGGCGGGGACGTGG - Intronic
1197066730 X:122242139-122242161 AAGAATGGGGTGGAGCTACCAGG - Intergenic
1197151375 X:123223555-123223577 CAGAATGTAGGGCTGCTAGAAGG + Intronic
1199748474 X:150791826-150791848 CAAAATGTGGGGCTTCTACAGGG + Intronic
1199885420 X:152016522-152016544 CAGAATGAAGGGCAGCTCCTAGG + Intergenic