ID: 1159469435

View in Genome Browser
Species Human (GRCh38)
Location 18:68832578-68832600
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1394
Summary {0: 24, 1: 33, 2: 46, 3: 144, 4: 1147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159469428_1159469435 16 Left 1159469428 18:68832539-68832561 CCGGAAACCTTGGTTTTTAGCTT 0: 1
1: 0
2: 8
3: 77
4: 303
Right 1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG 0: 24
1: 33
2: 46
3: 144
4: 1147
1159469429_1159469435 9 Left 1159469429 18:68832546-68832568 CCTTGGTTTTTAGCTTCTGTTTC 0: 1
1: 9
2: 59
3: 102
4: 506
Right 1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG 0: 24
1: 33
2: 46
3: 144
4: 1147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900031452 1:375790-375812 GGGGAGAAGAGAGATAAGGAGGG - Intergenic
900034569 1:396344-396366 GTGGAAAAGAGGCATTAAGCTGG - Intergenic
900052003 1:603990-604012 GGGGAGAAGAGAGATAAGGAGGG - Intergenic
900055400 1:626232-626254 GTGGAAAAGAGGCATTAAGCTGG - Intergenic
900323361 1:2095743-2095765 GCGGAAAGGAGGGGAGAGGAGGG - Intronic
900494155 1:2968936-2968958 GTGGAAAGGAGGCAGGAGGCTGG - Intergenic
900576585 1:3385555-3385577 GTGGAAAAGAGCAATGAAGCAGG + Intronic
900701273 1:4049927-4049949 GAGGGAAAGAGGGAGAAGGAAGG + Intergenic
900714441 1:4135061-4135083 GTGGAAAAGAGGGACTGGCATGG + Intergenic
900856278 1:5187431-5187453 TTGGAAATGGGGGATGGGGATGG + Intergenic
900857630 1:5198753-5198775 GCAGAAAAGAGGGATGAAAAGGG + Intergenic
900993562 1:6108699-6108721 GAGGAATGGAGGGATGATGAAGG + Intronic
901018604 1:6245055-6245077 GGGGAAGAGAGGGAAGGGGAAGG - Intronic
901752450 1:11419068-11419090 ATGGAACAGAGTGATGAAGAGGG - Intergenic
901769045 1:11521328-11521350 GGAGAAAGGAGGGAAGAGGAGGG + Intronic
902391196 1:16107934-16107956 CTGGAAAAGAAAGATCAGGAGGG + Intergenic
902653840 1:17854073-17854095 GGGGAAAAGAAAGAAGAGGAAGG - Intergenic
902709303 1:18227685-18227707 GTTGAAGAGAGGGAAGAAGAGGG + Intronic
902719142 1:18292522-18292544 CTGGAAAACAGGGATGGGGTAGG - Intronic
902870977 1:19313292-19313314 GTGGAAGAGAGAGAAGAGGAAGG - Intronic
903351944 1:22722573-22722595 GTGGAAAACAGGGATCATGCAGG - Intronic
903447959 1:23434447-23434469 GGGGAAAGGAGGGAAGAGAATGG + Intronic
903639602 1:24849295-24849317 GGGGAAAAGAGGGGGGAAGAGGG - Intergenic
903680127 1:25090910-25090932 GAGGCAAAGGGGGATGACGAGGG + Intergenic
903782786 1:25832735-25832757 GTAGGAAAGAGAGAGGAGGAGGG + Exonic
904123813 1:28222130-28222152 GATGAAAAGAGTTATGAGGATGG + Intronic
904179400 1:28655314-28655336 TTGGGAAAGAGGTATGTGGATGG - Intergenic
904262586 1:29298375-29298397 TTGGAAAAGAAGGAAGTGGAAGG - Intronic
904265991 1:29318885-29318907 GCGGAAATGAGGGATGCCGATGG + Intronic
904286731 1:29457700-29457722 GTGGAAGACAGGGCTGAGAAGGG - Intergenic
904302786 1:29566193-29566215 GTGGAAAAGAGAGGTGAGGAAGG + Intergenic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904463227 1:30692729-30692751 GAAGAAGAGAGGGAGGAGGAGGG + Intergenic
904581678 1:31548476-31548498 GAGGAGAAGAGGGATGGGGGTGG + Intergenic
904686804 1:32266655-32266677 GGGGAGGAGAGGGATGAGGAGGG - Intronic
904880287 1:33691188-33691210 GTGGAAAATAAGGTTGGGGAGGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
904974856 1:34448063-34448085 GGGGATAGGAGGAATGAGGATGG - Intergenic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905389462 1:37626846-37626868 GTGGGAATGAGGGCTCAGGAAGG + Intronic
905649759 1:39648240-39648262 GGGGAGAAGATGGATGAGCATGG + Intergenic
905799942 1:40837041-40837063 GGGGAAAAGGGGAAAGAGGATGG - Intronic
905942944 1:41878760-41878782 TAGGAAGAGAGGGAGGAGGAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906302282 1:44691584-44691606 GTAGAGAAGAGGGACGAGGATGG - Intronic
906383553 1:45347972-45347994 CTGATAAAGAGGGATGAGAATGG - Exonic
906848030 1:49215811-49215833 GGGGGAAAGAGGGAGAAGGAAGG - Intronic
907680599 1:56559814-56559836 CTGGAAAATGGGGATGAGGAAGG + Intronic
907744167 1:57196056-57196078 GTGGGAGAGTGGGATGAAGAAGG + Intronic
907792276 1:57678592-57678614 TAGGAAAAGAGGCCTGAGGAAGG + Intronic
908210315 1:61893896-61893918 GTGGAAAATGGAGAGGAGGAAGG + Intronic
909090052 1:71214560-71214582 GGGGAAAAGTGGGAAGTGGAGGG - Intergenic
909155608 1:72071658-72071680 GTGCAAAAGTGGGATGAGAGAGG - Intronic
909392856 1:75136169-75136191 GAAGAAAAGAGGATTGAGGAGGG - Intronic
910256469 1:85253122-85253144 GCAGAAAAGAAGGATGATGAAGG + Intronic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910377319 1:86586759-86586781 GTAAAAAAGAGAGAAGAGGAAGG + Intergenic
910428351 1:87137945-87137967 ATGGAACAGCGGGATGAGCATGG + Intronic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911100845 1:94094754-94094776 GGGGAAGAGGGGGAGGAGGAGGG + Intronic
911661771 1:100509312-100509334 ACACAAAAGAGGGATGAGGAAGG - Intronic
911705896 1:101012342-101012364 GCAGAAAAGAGGGATGAGGAAGG + Intronic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912328038 1:108787407-108787429 GTGGAAAAGAGGGATAAGGAAGG - Intronic
912383604 1:109260572-109260594 GTGGGAAGGAGGGAGGAGGGAGG + Intronic
912651016 1:111439611-111439633 GTGGAAATGTGTGATAAGGAAGG - Intergenic
912959074 1:114179372-114179394 GAGAGGAAGAGGGATGAGGAAGG - Intergenic
913175060 1:116266033-116266055 GCAGATAAGAAGGATGAGGAAGG + Intergenic
913323714 1:117607781-117607803 GTGGAAAAGGGGGAGGGGGATGG + Intronic
913478518 1:119262304-119262326 GTACAGAAGAGGGAAGAGGAGGG - Intergenic
914355084 1:146877908-146877930 GGGGCAAAGAAGGATGAGAAGGG - Intergenic
914513431 1:148353912-148353934 GAGGAAAAGGGAGAGGAGGAGGG - Intergenic
914739208 1:150449551-150449573 GAGGAAAGGAGGGAGGAAGAGGG - Intronic
914786507 1:150837235-150837257 CTGAAAAAGAGAGATGAGGTGGG - Intronic
914933669 1:151959076-151959098 GTGAGAAAGAGGGATTAAGAGGG - Intergenic
915254653 1:154617240-154617262 GTGGCAATGAGGGATGAGGTAGG - Intronic
915430317 1:155860754-155860776 GTGGAAAATAGGGAAGAAGGTGG + Intronic
915472896 1:156136380-156136402 GTGGAGGAGGTGGATGAGGAGGG + Exonic
915739991 1:158111995-158112017 TTGGACATGAGGGGTGAGGAAGG - Intergenic
915897041 1:159820180-159820202 GAGGAAGAGAAAGATGAGGATGG - Intergenic
915972649 1:160365452-160365474 GGGGAAAGGAGGCTTGAGGAGGG - Intergenic
916118646 1:161509372-161509394 GTGGAAAAAAGGGGGGAAGAAGG + Intronic
916193080 1:162197937-162197959 ATGCAAAGGAGGTATGAGGAGGG + Intronic
916597976 1:166263961-166263983 GAGGGTAAGAGGGATGAGAATGG - Intergenic
916635377 1:166662437-166662459 GTATAAAAGAGGACTGAGGATGG + Intergenic
916819579 1:168385354-168385376 GAGGAGAAAAGGGATAAGGAGGG + Intergenic
917071072 1:171151608-171151630 GTGTAAAATGGGGATGATGATGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917737342 1:177932937-177932959 GCAGAAGAGTGGGATGAGGAGGG - Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917967377 1:180187136-180187158 GTGGGAAGGAGGGATCAGGCTGG - Intronic
918164737 1:181934377-181934399 GTGGGAAAGAAGGATGGAGAAGG + Intergenic
918241715 1:182626145-182626167 GTGGGCAAGAGGGATGCTGATGG - Intergenic
918312278 1:183293273-183293295 GTGGCAGGGAGGGATGAGCAGGG + Intronic
918687335 1:187434090-187434112 TGGGAAAAAAGGGTTGAGGAGGG + Intergenic
918787917 1:188788765-188788787 GAAGAAAAGAGAGAGGAGGATGG + Intergenic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919233281 1:194804219-194804241 TTGGGAAAGGGGGATGAAGATGG - Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919469599 1:197961740-197961762 AAGAAAAAGAGGGATGAAGAAGG - Intergenic
920285520 1:204875932-204875954 GGGGAAAAGTGGAAGGAGGAGGG + Intronic
920371215 1:205480641-205480663 ACGGGAAAGAGGGATGAGGCTGG + Intergenic
920374878 1:205502894-205502916 GGGGACAAGAGAGAGGAGGAAGG - Intergenic
920703043 1:208232117-208232139 GTGGGAAGGAGGGCTGGGGAGGG + Intronic
920732892 1:208504575-208504597 CTGGAAATGAGGGTCGAGGAAGG + Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920947065 1:210539526-210539548 CTGGTAAACAGGGATGAGGTGGG + Intronic
921139503 1:212292987-212293009 GCAGAAAAGAAGGACGAGGAAGG - Intronic
921264340 1:213410204-213410226 GTGGAAAAGAGGCAGCAGAAAGG + Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
922020705 1:221701289-221701311 TAGGGAAAGAGAGATGAGGAAGG - Intergenic
922434137 1:225586284-225586306 GAAGAAAAGAGGGGAGAGGAGGG + Intronic
923051374 1:230393254-230393276 AGGGAAAAGGGGGAGGAGGAGGG + Intronic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923092992 1:230753697-230753719 CTGGAAAAGTGGGAAGAGGTGGG + Intronic
923191363 1:231623698-231623720 GTGGATGAGAGGGATGAGTAAGG + Intronic
923602115 1:235412227-235412249 GGGGAAAGGAGGGAAGGGGAGGG - Intronic
923699651 1:236287773-236287795 GCAGAAAAAAGGGACGAGGAAGG - Intergenic
923752537 1:236759518-236759540 ATGAAAAAGAGGGGAGAGGAGGG - Intronic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924073512 1:240308509-240308531 GCAGAAAAGAGGGACGAGGACGG + Intronic
924217572 1:241839849-241839871 CTGGAAAACAGGGCTGGGGAAGG - Intergenic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
924574282 1:245265375-245265397 GTGGACAAGTGGGAGAAGGAAGG + Intronic
924907630 1:248473493-248473515 GTGGATGAGGAGGATGAGGAGGG - Exonic
924916479 1:248574593-248574615 GTGGATGAGGAGGATGAGGAGGG + Exonic
924956178 1:248929664-248929686 GTGGAAAAGACTAATGATGATGG - Intergenic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063225684 10:4013182-4013204 GAGGAAAAGGGGGATGAGGAGGG - Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063707830 10:8448079-8448101 GGGGGCTAGAGGGATGAGGATGG + Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064283074 10:13969026-13969048 GTAGAAAGGAGGGCTGGGGAAGG + Intronic
1064371375 10:14754500-14754522 CTGGAAGAGAGAGATGAGCAGGG - Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1065424659 10:25587060-25587082 GTGGAAAACAGGAATTAGGGAGG + Intronic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1065867672 10:29927956-29927978 ATAGAAAAGAGGGATGATCAGGG + Intergenic
1065947851 10:30623825-30623847 GTGGACGAGGGGGAGGAGGATGG - Intronic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066094236 10:32057066-32057088 GTGGAACAGTAGGGTGAGGAGGG + Intergenic
1066156684 10:32685460-32685482 GCAGAAAAGAGGAATGAGAAAGG + Intronic
1066523341 10:36247812-36247834 GAGGAGAAGAGGGGAGAGGAGGG - Intergenic
1066622103 10:37366909-37366931 GTGGAACCCATGGATGAGGAGGG + Intronic
1066638960 10:37536467-37536489 GCAGAAAAGACGGATGAGGAAGG + Intergenic
1066716248 10:38289529-38289551 GCAGAAAAGTGGGATGAGGAAGG + Intergenic
1067012589 10:42728348-42728370 GTGGAGAAGAGGGTGGAGGGAGG + Intergenic
1067307960 10:45083330-45083352 GAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1067314704 10:45150888-45150910 TTGGAAGAGAGGGTTGATGAGGG - Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1067709675 10:48637889-48637911 GTGGAAAAGGGGGAGAAAGAAGG - Intronic
1067731232 10:48812890-48812912 GTGGGAAAGAGGAGTGAGTAAGG - Intronic
1067859224 10:49827496-49827518 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1067944945 10:50683486-50683508 GAGGCAGAGAGGGAGGAGGACGG - Intergenic
1068184699 10:53569797-53569819 GAAGAAAAGAGGGAAAAGGAGGG + Intergenic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068595103 10:58894802-58894824 GAGTAAAAGAGGGAGGAGGATGG + Intergenic
1069093949 10:64235727-64235749 ATAGAAAAGAGTGATGAAGAAGG + Intergenic
1069180891 10:65357211-65357233 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1069634058 10:69914587-69914609 GTAGAAGAGAGGGATGACGGGGG + Intronic
1069718496 10:70535485-70535507 GAGGAAGAGAGGGAGAAGGAAGG - Intronic
1070330101 10:75410266-75410288 AAGGAAAGAAGGGATGAGGATGG - Intergenic
1070350993 10:75592122-75592144 GTGGCAAAGAGGAATGAGCTGGG + Intronic
1070352152 10:75602934-75602956 GGGAAAAAGAAGTATGAGGAGGG - Intronic
1070661228 10:78306780-78306802 GTGGAAAAGAGGGTGAAGGAAGG + Intergenic
1070722264 10:78764919-78764941 GTGGAAATGAGGGCTGAGCCTGG - Intergenic
1070866446 10:79710357-79710379 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1070880239 10:79848488-79848510 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1071119700 10:82263196-82263218 GTGGGAAAGAAAGATGTGGATGG + Intronic
1071207552 10:83298807-83298829 GAGGAAAAGAAGGAAGAGAATGG + Intergenic
1071541812 10:86492025-86492047 GTGGATACCAGGGATGAGGAGGG - Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071633356 10:87232578-87232600 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1071646805 10:87364796-87364818 GAGGCAGAGAGGGAGGAGGACGG - Intronic
1071868860 10:89769332-89769354 GCAGAAAACAGGGATGAGGAAGG - Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072433370 10:95393536-95393558 CTGGAAAACAGCGATGATGAAGG - Intronic
1072563150 10:96595591-96595613 GTGGAACAGGTGGAGGAGGATGG + Exonic
1072763958 10:98081078-98081100 GAGAAAGAGAGGGAAGAGGAAGG - Intergenic
1072782331 10:98259299-98259321 GTAGAAAGGAGGGAAGGGGAGGG + Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073448992 10:103598372-103598394 GTCACAAAGAGGGATGAGGTGGG + Exonic
1073852322 10:107635206-107635228 AGGGAAAACAGGGGTGAGGATGG - Intergenic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075084021 10:119402043-119402065 GAGGAAGAGAGGGATGAAGGAGG + Intronic
1075126029 10:119699733-119699755 GTGGAAAAGAGGGAACAGGTTGG - Intergenic
1075324800 10:121522787-121522809 GAGGAAGAGAGGGAGGAGGCTGG - Intronic
1075409837 10:122219236-122219258 GTGTGAAACAGGGATGAGGTGGG - Intronic
1075529861 10:123219960-123219982 GGGGAAAGGAGGGAAGAGCAGGG - Intergenic
1076161348 10:128246547-128246569 AAGGAAGAGAGGGAGGAGGATGG - Intergenic
1076163993 10:128267783-128267805 GAGGAAAGGAAGGAGGAGGAAGG - Intergenic
1076318947 10:129564389-129564411 GAGGAAGAGAAGGAGGAGGAGGG - Intronic
1076744195 10:132504620-132504642 GTGGAACAGAGGGGTGTAGAGGG + Intergenic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077009732 11:374714-374736 GGGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009738 11:374729-374751 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009744 11:374744-374766 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009750 11:374759-374781 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009756 11:374774-374796 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009762 11:374789-374811 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009768 11:374804-374826 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009774 11:374819-374841 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009812 11:374910-374932 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009834 11:374963-374985 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009840 11:374978-375000 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009862 11:375031-375053 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009874 11:375061-375083 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009886 11:375091-375113 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009892 11:375106-375128 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009898 11:375121-375143 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009904 11:375136-375158 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009916 11:375166-375188 GTGGAAGGGAGGGAGGAGGAAGG + Intronic
1077009922 11:375181-375203 GAGGAAGGGAGGGAGGAGGAAGG + Intronic
1077282577 11:1752356-1752378 CGGGACAAGAGGGCTGAGGAGGG + Intronic
1077385106 11:2265723-2265745 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1077565000 11:3292061-3292083 GTGGAAGAGAAGGATGAAGCAGG - Intergenic
1077570886 11:3337878-3337900 GTGGAAGAGAAGGATGAAGCAGG - Intergenic
1077676049 11:4193701-4193723 GTGGAAAAATGAGATGGGGAGGG + Intergenic
1077957633 11:7038132-7038154 GGGGATAGAAGGGATGAGGATGG + Intronic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078582941 11:12553092-12553114 GTGGAAAGGAGGCAGGGGGATGG - Intergenic
1078721652 11:13890044-13890066 CTGGCAAAGAGGGAAGAGAAGGG - Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078757277 11:14223072-14223094 GTGGAAAAGTGGGCCGAGCATGG + Intronic
1079173324 11:18116635-18116657 GTAGAAGAGGGGGAAGAGGAGGG + Intronic
1079282483 11:19099876-19099898 GCAGAAAAGAGGACTGAGGAGGG - Intergenic
1079294437 11:19219687-19219709 GCAGAAAAGAGGGGTGAGAAAGG + Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080876602 11:36280286-36280308 GTGGGACAGAGGGGTGAGGAGGG + Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081744451 11:45463176-45463198 GTAGAAGAAAGGGAGGAGGAAGG + Intergenic
1081747222 11:45481749-45481771 GAGGAAGAGAGGAAAGAGGAAGG - Intergenic
1082187784 11:49205456-49205478 GTGGAAAAGAGAGCTCAGAAAGG + Intronic
1082223900 11:49677698-49677720 GGGGAGAGGAGGGAAGAGGAGGG - Intergenic
1082680799 11:56166550-56166572 AAGGAAAAGATGGATGAGAAGGG - Intergenic
1082811767 11:57482832-57482854 GTGGAACAGATGGCTGGGGAGGG - Intergenic
1082862841 11:57872134-57872156 GTGGAAGAGAGGGATTGGGAAGG - Intergenic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083406704 11:62462283-62462305 GTGCTAAAGAGGGCTGAGGCAGG - Intronic
1083823671 11:65186472-65186494 GTGGAAGTGATGGATGAGGCAGG - Intronic
1083830896 11:65232942-65232964 GTGGTAGAAAGGGATGTGGAGGG + Intergenic
1083848183 11:65348822-65348844 GTAGGCAAGAGGGAAGAGGATGG - Intronic
1084209680 11:67615237-67615259 GTGGAGCAGAGGGATGGGGCTGG - Intergenic
1084443851 11:69192011-69192033 GTGGCAAACTGGGATGAGGATGG + Intergenic
1084529275 11:69717501-69717523 GAGGAGAGGAGGGAAGAGGAGGG - Intergenic
1084576201 11:69989492-69989514 GAGGGAAAGAGGGAGCAGGAGGG + Intergenic
1084635491 11:70389647-70389669 GTAGAAAAGAGGGATAAGGAAGG - Intergenic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085229199 11:74949983-74950005 GTAGCAAAGAGGGAGGTGGAGGG - Intronic
1085282649 11:75341053-75341075 ATGGAAAAGAGGGATGAAAGAGG + Intronic
1086144962 11:83541610-83541632 GTGGAGATGAGGGAAGAAGAAGG - Intronic
1086348603 11:85922731-85922753 ATGGAGAAGAGTGATGAGAAGGG - Intergenic
1086486485 11:87308164-87308186 GGGGATAACAGTGATGAGGAGGG - Intronic
1086499200 11:87434943-87434965 GGGGAAAAAAAGGATGATGATGG - Intergenic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1086897675 11:92332558-92332580 GCAGAAGAGAGGGTTGAGGAAGG + Intergenic
1087730587 11:101774166-101774188 GAGGAGCTGAGGGATGAGGAAGG + Intronic
1087794150 11:102437983-102438005 GTGGAAAAAAGTGACTAGGAAGG - Intronic
1087985731 11:104677201-104677223 GAGGGAAAGAGGCATGAGTAAGG - Intergenic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088326775 11:108608909-108608931 GAGGAAGAGAGGAAAGAGGAGGG + Intergenic
1088442666 11:109889010-109889032 AAGGAAAAGAGGGGTAAGGAGGG - Intergenic
1088620083 11:111672614-111672636 GTGGAAAAGATTGATTAGAAAGG + Intronic
1089081276 11:115777989-115778011 GTAGACAGGAGGGAGGAGGAAGG + Intergenic
1089231405 11:116980332-116980354 GCGGAAAAGAGGGTTGAGGAAGG - Intronic
1089714517 11:120345172-120345194 AACGGAAAGAGGGATGAGGAAGG + Intronic
1089743413 11:120600516-120600538 TTTGAACAGAGGGCTGAGGAGGG + Intronic
1089894496 11:121915822-121915844 GAGGAAAAGAGAGAAGAAGAAGG - Intergenic
1089957539 11:122585646-122585668 GAGAAAAAGAGGCAGGAGGAAGG + Intergenic
1090064106 11:123488668-123488690 GTGGCAACGGGGGAGGAGGAGGG - Intergenic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090217664 11:124984216-124984238 CTGGAAAAGTGGCATGAGGGAGG + Intronic
1090426196 11:126608533-126608555 GGGGAGAGGAGGGAAGAGGAGGG - Intronic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1090746288 11:129707730-129707752 GCGGAAAAGTGGGATGAGGAAGG + Intergenic
1091000582 11:131907651-131907673 GTGGGAAAGAGGGTGGAGGTGGG + Intronic
1091034644 11:132222239-132222261 GTGGAAGAGAGGAAAGAGAAAGG - Intronic
1091145168 11:133273221-133273243 GTGAACCAGAGGGATGGGGAGGG + Intronic
1091145527 11:133276159-133276181 GTGGCAAAGAGGGAAAATGAGGG + Intronic
1091326348 11:134691426-134691448 GTAGAAATGAGGGAGGAGCATGG - Intergenic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091339840 11:134801702-134801724 GGGGAAGAGAGGGATGCGGGTGG + Intergenic
1091352194 11:134906494-134906516 GGGGAAGACAGGGATGAGAACGG + Intergenic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091596535 12:1882538-1882560 GTGGGAGGGAGGGATGATGAGGG + Intronic
1091603140 12:1929956-1929978 GAGGAAGAGTGGGATGAAGAGGG + Intergenic
1091978443 12:4845838-4845860 ATGCAAGATAGGGATGAGGAAGG - Intronic
1091991255 12:4957831-4957853 AAGGAAAGGAGGGAAGAGGAAGG - Intergenic
1092092107 12:5812065-5812087 GGGGAGAAGAGGGGAGAGGAAGG + Intronic
1092312531 12:7374025-7374047 AGAGGAAAGAGGGATGAGGAAGG - Intronic
1092521826 12:9283814-9283836 GAGGAACAGCGGGACGAGGAAGG + Intergenic
1092944737 12:13442195-13442217 CAGGGAAAGAGAGATGAGGAGGG - Intergenic
1093426822 12:19037112-19037134 CTGGAAAACAGGAATTAGGAAGG + Intergenic
1093511188 12:19930309-19930331 GTGGAGAAGAGGCATAAGAAAGG - Intergenic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1093569969 12:20655520-20655542 GCAGAACAGTGGGATGAGGAAGG - Intronic
1093652333 12:21659550-21659572 ATGGAAATGAGGGTAGAGGAGGG - Intronic
1093679170 12:21981320-21981342 GTGATACAGAGGGAGGAGGAGGG + Intergenic
1093702372 12:22236503-22236525 TTTAAAAAGAGGGCTGAGGAGGG + Intronic
1093993062 12:25611423-25611445 GAGGAATACAGTGATGAGGAGGG + Intronic
1094264697 12:28543472-28543494 GCAGAAAAGAGCGATGGGGAAGG + Intronic
1094339388 12:29393639-29393661 GTGGAAGAGGGAGAAGAGGAAGG + Intergenic
1094619254 12:32064580-32064602 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1095300411 12:40578086-40578108 GGAGAAAAGAAGGAGGAGGAAGG - Intergenic
1095994992 12:48074366-48074388 GTGGAACAGAGTGGTGATGATGG + Exonic
1095999731 12:48119288-48119310 GAGGCAAAGAGGGAGGGGGAAGG - Intronic
1096004958 12:48162012-48162034 GTGTAAAAGTGGGAGGAGGTAGG - Intronic
1096576248 12:52554609-52554631 ATGGATGGGAGGGATGAGGAGGG - Intergenic
1097124242 12:56760809-56760831 TTGGACATGGGGGATGAGGAAGG + Intronic
1097392500 12:59032819-59032841 GTGGAAAAGATAGGAGAGGAGGG + Intergenic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097788568 12:63789027-63789049 GCAGAAAAGAGGGATAAGGAAGG + Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098159294 12:67633687-67633709 GGGGAAAAGATGCATGGGGAGGG + Intergenic
1098167785 12:67715812-67715834 ATGGCAAAGAGGGAAGAGGGAGG + Intergenic
1098197630 12:68018592-68018614 GAGGAACAGAGGAAGGAGGAAGG + Intergenic
1098203136 12:68078498-68078520 GCGAAAAAGAGGGAGGAGGAAGG - Intergenic
1098239172 12:68448874-68448896 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1098353915 12:69591797-69591819 GCAGAAAAGAGGGAGGAGGAAGG - Intronic
1098791214 12:74825455-74825477 GTGGAAAATGGAGAAGAGGAAGG + Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1098890962 12:76010531-76010553 GTGGAAAAGAAGGAGGTGGCAGG - Intergenic
1099114525 12:78608354-78608376 GTAAAAAGGAGGGATGAAGAAGG + Intergenic
1099146882 12:79057776-79057798 GCAGGAAGGAGGGATGAGGAAGG - Intronic
1099174958 12:79410433-79410455 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099532270 12:83798930-83798952 GTGGTAAAGATGGAAGAGAAAGG - Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1099800104 12:87446107-87446129 GTGGAAAAGAGTGATTAGTGAGG - Intergenic
1099930353 12:89067118-89067140 GTTGAAAAGTGGAAAGAGGATGG + Intergenic
1099982944 12:89628075-89628097 GGGGTAGAGAGGGAGGAGGAAGG + Intronic
1100351676 12:93789600-93789622 GTGGAAGGGAGGGATGACAAAGG + Intronic
1100569800 12:95837142-95837164 GAGGGAGAGAGGGATGAGGGAGG + Intergenic
1100656456 12:96650961-96650983 GTGAAACTGAGGGCTGAGGATGG - Intronic
1100666394 12:96758204-96758226 GAGGAAATGAGGGAGAAGGAGGG + Intronic
1101363777 12:104052716-104052738 GGGGTAAAGAGAGAAGAGGAGGG - Intronic
1101438431 12:104684048-104684070 GTGGAAATGAGGGAGGAGCGAGG + Intronic
1101466983 12:104958555-104958577 GTGGGGAAGAGGGATGCCGAAGG - Intronic
1101578770 12:106022721-106022743 GGAGAAAAGAGAGATGAAGAGGG + Intergenic
1101676385 12:106920930-106920952 GCAGAAAAGAGGCAAGAGGAAGG + Intergenic
1101697963 12:107144505-107144527 GTTGAAATGAGTGGTGAGGATGG - Intergenic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1102558034 12:113741824-113741846 GGGGGAAGGAGGGAGGAGGAGGG + Intergenic
1102797144 12:115698337-115698359 GGGGAGGAGAGGGAAGAGGAAGG + Intergenic
1102904377 12:116662878-116662900 GCGGAAGAGGGGGAGGAGGAAGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103058891 12:117842982-117843004 TTGGGAAGGAGGGAGGAGGAAGG + Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1104001723 12:124864260-124864282 GAGGAGGAGAGGGAGGAGGAGGG - Intronic
1104153706 12:126109962-126109984 GAGGAAGAGAGGGAGAAGGAAGG - Intergenic
1104178815 12:126357952-126357974 GGGGAAGAGAGGGAAGAGGAGGG + Intergenic
1104346275 12:128002056-128002078 GTGGAAATGAGGGATGGGAGGGG + Intergenic
1104485241 12:129145876-129145898 GTGGAAAAGAGAGATGAGGAAGG - Intronic
1104602979 12:130165485-130165507 GTGGAAAGGAGGGGGGAAGAGGG + Exonic
1104682770 12:130762626-130762648 GTGAGAAGGAGGGCTGAGGACGG + Intergenic
1104791315 12:131483783-131483805 ATGGAAACCAGGGATGGGGAGGG + Intergenic
1104854098 12:131894274-131894296 GGGAAAAGGAGGGAGGAGGACGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105996054 13:25672959-25672981 GTGGAAAAGAGGGAGGGAGCAGG + Intronic
1106083723 13:26521936-26521958 GTGACAAAGAGGGATGAGAGGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1106917711 13:34532856-34532878 GTGGAAAGGGGGTAGGAGGAAGG - Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1107731057 13:43349497-43349519 GTGGAAGAGAGGGAGAAGGAAGG - Intronic
1107767819 13:43756435-43756457 GGAGAGAAGAGGGTTGAGGAGGG + Intronic
1107785576 13:43953589-43953611 GTGGCAAAGAGGGTTGTGGTGGG + Intergenic
1107983490 13:45755330-45755352 TTGGTAAAGAGGTATGTGGATGG - Intergenic
1108260019 13:48646810-48646832 TTGGAAAATAGGCATGAGGAAGG - Intergenic
1108322457 13:49301939-49301961 GTGGAATGGAGGGAGGAAGAAGG + Intergenic
1108571351 13:51754957-51754979 GGGGAAATGAGAGATGAGGCTGG - Intronic
1108841852 13:54627727-54627749 AGGATAAAGAGGGATGAGGAGGG + Intergenic
1109321544 13:60816576-60816598 GAGGAAGGGAGGGAGGAGGAGGG - Intergenic
1109570545 13:64183374-64183396 GTGGAAAATTGGAAGGAGGAAGG - Intergenic
1109589672 13:64462169-64462191 TTGAAAAAGAGGGGTTAGGATGG - Intergenic
1110119545 13:71865610-71865632 GGGGACGAGAGGGAGGAGGACGG - Intronic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110301012 13:73927417-73927439 GTGGAAAACACGGATGGGAATGG - Intronic
1110369195 13:74720716-74720738 ATGGAAAAGAGAGGTCAGGAAGG - Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111149902 13:84237490-84237512 GTGGTAAAAAGTGATGAGAAAGG + Intergenic
1111427885 13:88112883-88112905 GTGGAAAAGAGACATGATTAAGG + Intergenic
1112350121 13:98626295-98626317 GTGGAAAGGAGAGGAGAGGAGGG + Intergenic
1112565250 13:100546850-100546872 GTGGTTTAGAGGCATGAGGATGG - Intronic
1112778239 13:102868573-102868595 GGGGAAAGGAGAGATGAGTAAGG + Intronic
1112810255 13:103210027-103210049 GTGGCAAAGAAAGATGAAGATGG + Intergenic
1112915181 13:104539487-104539509 GTGGAGGAGAGGTATGTGGAAGG + Intergenic
1112917549 13:104569981-104570003 GTTTAAAAGAGGGATGGGGCCGG + Intergenic
1113111866 13:106831918-106831940 GAAGAAAAGAGGGGTGATGAGGG + Intergenic
1113215902 13:108040296-108040318 TGGGAAAAGAGGGGTGAGGTTGG - Intergenic
1114263616 14:21057853-21057875 GTGGAACAGAGTGAGGAGGTAGG - Exonic
1114642834 14:24235844-24235866 CTGGAAAACTGGGATAAGGAAGG - Intronic
1115106108 14:29763451-29763473 GTGGAAAGGAGGGAAGGGGAGGG + Intronic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1116023208 14:39486011-39486033 CTGGAAAAGGGGCATGAGAATGG - Intergenic
1116095549 14:40362419-40362441 GAGGAAGAGAAGGAAGAGGAGGG - Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1117079600 14:52137582-52137604 GTGGAAGAGGGAGAAGAGGAAGG + Intergenic
1117322727 14:54639467-54639489 GGGCAAAGGAGGGAGGAGGAAGG + Intronic
1117512335 14:56465527-56465549 GAGGAAAAGATGGATGGGGTGGG + Intergenic
1117679170 14:58185593-58185615 GTGGGAAAGAAAGATGATGAAGG + Intronic
1118110730 14:62715856-62715878 GAGGAAAGGAGGGATAGGGAAGG + Intronic
1118128368 14:62935069-62935091 GTGGAAAAGTGGGGGGATGAGGG + Intronic
1118741276 14:68741200-68741222 GGGGATAAGAGGGATGGGGGAGG - Intergenic
1118872006 14:69750889-69750911 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1118880689 14:69823388-69823410 TTGGGAAAGAGGTATGTGGACGG - Intergenic
1119606642 14:76023982-76024004 GCAGAAAAGAGGAATGAAGAAGG - Intronic
1119639961 14:76307492-76307514 TTGAAAAGGAGGGATTAGGAAGG + Intergenic
1120010330 14:79406269-79406291 GGGGAGAAGAGGGGAGAGGAGGG - Intronic
1120035416 14:79691367-79691389 GAGGAAAGGAGGGAAGTGGAGGG + Intronic
1120061070 14:79983300-79983322 GAGGAAGAGAGGGAGAAGGAGGG + Intergenic
1120316904 14:82905909-82905931 GTGGCAAAGGCAGATGAGGAAGG + Intergenic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120791650 14:88589719-88589741 GAGGTAGAGAGGGAAGAGGAAGG - Intronic
1121523122 14:94599838-94599860 GTGGAGAGTAGGGATGTGGAGGG + Intronic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121606458 14:95244018-95244040 GAGGAAAAGAGAGAGGGGGAAGG - Intronic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1121800146 14:96768486-96768508 GAGGAAGGGAGGGAGGAGGAAGG - Intergenic
1121861703 14:97324780-97324802 GAGGAAATGGGGGTTGAGGAAGG - Intergenic
1121925434 14:97923118-97923140 GTGGGACAGAGAGATGTGGATGG - Intergenic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122258479 14:100498375-100498397 GTGGAAAAGGGGCATGCAGAGGG - Intronic
1122610923 14:102983022-102983044 GAGGAAAAGAGGAAACAGGATGG + Intronic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1123988864 15:25668483-25668505 GAAGAAAGGAGGGATGAGGGAGG - Intergenic
1124204270 15:27703874-27703896 GTGGAACAGGTGGATGAGGGCGG + Intergenic
1124861425 15:33445613-33445635 GTAGAAAAATGGGATGAGGAGGG - Intronic
1124897371 15:33789449-33789471 GTGGGAGAGAGTGATGGGGAGGG + Intronic
1124957841 15:34371151-34371173 GGGGAAGAGAAGGAGGAGGAAGG - Intergenic
1125281588 15:38047552-38047574 GAGGAAAAGAGGGAAGGGGGAGG + Intergenic
1125344717 15:38707481-38707503 GTGGAAAAGTGAAATGAGGGAGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1126850763 15:52795577-52795599 GTGGAAAAGTGTGAAGGGGAAGG - Intergenic
1126917794 15:53484736-53484758 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1127151282 15:56078130-56078152 GAAGAAAAGTGGGATGAGGAGGG - Intergenic
1127251233 15:57240579-57240601 GTGGTAAAGAGGTATGTTGAGGG + Intronic
1127845373 15:62866082-62866104 GTGGAGAAGGTGGATGAGGTTGG + Intergenic
1128532381 15:68463336-68463358 GAGGAGATGAGGGATGAGGAAGG + Intergenic
1128548891 15:68584999-68585021 GCAAAAAGGAGGGATGAGGAAGG - Intronic
1128629809 15:69253133-69253155 GGGTGAAAGAGGTATGAGGAGGG - Intronic
1128726889 15:69994602-69994624 GCAGAAAAGAGGAAAGAGGAAGG - Intergenic
1128783203 15:70376443-70376465 GAAGAAGAGAGGGAAGAGGAAGG + Intergenic
1129040514 15:72682351-72682373 GTGGAAGAAAAGGAAGAGGATGG - Intronic
1129102828 15:73282003-73282025 GAGGAAAAAAGGGATAAGGCTGG - Intronic
1129820381 15:78597499-78597521 GAGGGAAAGAGTGATGAGGATGG - Intronic
1129862080 15:78870941-78870963 GTGGAAAAGGGGGATGAGGAAGG - Intronic
1130018449 15:80205705-80205727 GTGGAAAAGTTGGACTAGGAAGG - Intergenic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130948861 15:88570018-88570040 CTGGAATATAAGGATGAGGAAGG + Intergenic
1131024726 15:89130519-89130541 GCAAAAAACAGGGATGAGGAAGG - Intronic
1131121269 15:89824572-89824594 CAGTAAAAGAGGGCTGAGGACGG + Intergenic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131451594 15:92544958-92544980 GAGAAAAAGAGGTGTGAGGAGGG - Intergenic
1131683127 15:94744852-94744874 GAGGAAAAAAGGGAAAAGGAAGG + Intergenic
1131736616 15:95339398-95339420 ATGGAAAAGAGGGAGGGGGAAGG + Intergenic
1132545249 16:530041-530063 GTGGGTACGAGGGATGCGGAAGG - Intronic
1132903548 16:2271019-2271041 CTGGGACACAGGGATGAGGATGG + Intergenic
1132934410 16:2473614-2473636 GAGGACCTGAGGGATGAGGATGG - Intronic
1133180368 16:4049664-4049686 GTGGACATGAAGGATGCGGAAGG - Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133567401 16:7008747-7008769 GAGGAAGGGAGGGAGGAGGAAGG - Intronic
1133717884 16:8466870-8466892 GTGGGAAAGAAAGAAGAGGAAGG + Intergenic
1133717937 16:8467088-8467110 GAGGGAGGGAGGGATGAGGAAGG + Intergenic
1133825365 16:9273527-9273549 GAGGAAGAGGGGGAAGAGGAGGG - Intergenic
1133867424 16:9657318-9657340 GGGGACAATAGGGATGATGATGG + Intergenic
1133961261 16:10495553-10495575 GAGAAAAAGAGGGAGAAGGAGGG - Intergenic
1134071952 16:11265758-11265780 TTGCGAAAGAGGAATGAGGAAGG + Intronic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134453641 16:14378719-14378741 GTGGAAGAAAGAGATGGGGAGGG + Intergenic
1134531560 16:14988346-14988368 GTGGAAGAGGGTGATGAGGGAGG + Intronic
1134613717 16:15632438-15632460 GCAGAAAAGAGAGATAAGGAAGG + Intronic
1134687596 16:16169609-16169631 TGGGAGGAGAGGGATGAGGAGGG + Intronic
1134754094 16:16650830-16650852 ATGGAAGAGAGGGAAGAGAAGGG - Intergenic
1134771332 16:16812149-16812171 GAGGAAGAGAGAGAGGAGGAGGG + Intergenic
1134814009 16:17191107-17191129 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1134991967 16:18708219-18708241 ATGGAAGAGAGGGAAGAGAAGGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135092085 16:19524985-19525007 CTGTAAAAGAGGGATGATCACGG - Intronic
1135133116 16:19868803-19868825 GCGGGACAGAGGGATGTGGATGG + Intronic
1135408089 16:22212669-22212691 GGGGAAGAGAGGGTTGGGGAGGG + Intronic
1135544544 16:23356930-23356952 GTGGGAAGGAGGCCTGAGGATGG + Intronic
1135829018 16:25756726-25756748 CTGGCACAGAGAGATGAGGAAGG + Intronic
1135942427 16:26834217-26834239 GTGAAGAAGAAGGAAGAGGAGGG + Intergenic
1135992025 16:27224145-27224167 GTTCAAGAGAGGGATGAAGATGG + Intergenic
1136071197 16:27788298-27788320 GAGTGTAAGAGGGATGAGGAAGG + Exonic
1136081342 16:27854319-27854341 AAGGAAAAGGGGGAGGAGGAGGG + Intronic
1136505815 16:30702522-30702544 GTGGAAAACAGGGCTGGGCACGG - Intronic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137404530 16:48179206-48179228 GCAGAAAAGTGAGATGAGGAAGG - Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137960561 16:52877946-52877968 ATAGAAATGAGGGATGAGGGTGG - Intergenic
1138136390 16:54526945-54526967 TTGGAAAAGAGAGCTGAAGAAGG - Intergenic
1138217222 16:55214757-55214779 GAGAAAAGGAGGGAGGAGGAAGG + Intergenic
1138326444 16:56175019-56175041 GTGGGAAAGGGGGAGGATGAGGG - Intergenic
1138535015 16:57655228-57655250 AGGGAAGGGAGGGATGAGGAGGG + Intronic
1139252096 16:65506337-65506359 GTGGGAGAGTGGGTTGAGGAGGG - Intergenic
1139300607 16:65942286-65942308 GAGGAAGGGAGGGATGGGGAGGG + Intergenic
1139424964 16:66873799-66873821 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1139925387 16:70483071-70483093 GGAGAAAAGAGGGATGGGGTGGG - Intronic
1139978932 16:70837621-70837643 GGGGCAAAGAAGGATGAGAAGGG + Intronic
1140489380 16:75321619-75321641 GCGGAAAAGAGGGGTGAGGAAGG + Intronic
1141211711 16:81987130-81987152 CTGGAAATGAGGGAGGAAGATGG - Intergenic
1141221105 16:82070042-82070064 GTGGAGAAGAAGGATTAGGTTGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141547385 16:84780155-84780177 ATAGAAACAAGGGATGAGGAGGG - Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141677793 16:85526610-85526632 GTGGAGAGCAGGGATGGGGAGGG + Intergenic
1141856384 16:86683868-86683890 GAGGCAAAGAGAGATGTGGAGGG - Intergenic
1142137821 16:88459719-88459741 GAGGAAGAGGGGGAGGAGGAAGG - Intronic
1142137847 16:88459779-88459801 GAGGAAGAGGGGGAGGAGGAGGG - Intronic
1142220686 16:88853554-88853576 TTGGAAAATAGGGTTAAGGAGGG - Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142632061 17:1231498-1231520 CTGGAAAAGTGGGACCAGGACGG - Intergenic
1143004048 17:3815584-3815606 GTGGAATCCATGGATGAGGAGGG - Intronic
1143125562 17:4639342-4639364 GTGGAGAAGAGGGCGCAGGATGG - Intronic
1143402914 17:6657470-6657492 GTGGAGAAGAGGGCGCAGGATGG + Intergenic
1143471274 17:7177499-7177521 GGAGAAAAGAGGGCTGGGGAAGG + Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1143993614 17:10988128-10988150 GTGTAGAAGAGGAATAAGGAAGG - Intergenic
1144018628 17:11220731-11220753 GAGGAAAAGAGGGAGAAGGGAGG - Intergenic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144455573 17:15415594-15415616 GTGAAAAAGAGGGATCCGTAGGG - Intergenic
1144595648 17:16568461-16568483 CTGGAAAAGAGTGAAGAGGTTGG + Intronic
1144645824 17:16972719-16972741 GTGTAAAACAAGGATGAGGTCGG + Intergenic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145777398 17:27539005-27539027 CTGGAAGGGAGGGATGGGGAAGG - Intronic
1145819469 17:27820990-27821012 GTGGCAGGGAGGTATGAGGAAGG + Intronic
1146191279 17:30769318-30769340 GAAGAAAAGAGGGATGGGTAGGG - Intergenic
1146336443 17:31975967-31975989 GAAGAAAAGAGGGATGGGCAGGG - Intronic
1146526324 17:33570004-33570026 GTGGAGAGGAGTGATGGGGAGGG - Intronic
1146839892 17:36143979-36144001 GAGGAAGAAAGAGATGAGGAGGG + Intergenic
1147134354 17:38426653-38426675 TTGATAAAAAGGGATGAGGAAGG + Intergenic
1147343946 17:39774375-39774397 GAGGAGAGGAGGGAAGAGGAGGG + Intronic
1147402670 17:40190555-40190577 CTGGAATGGAGGGCTGAGGAGGG + Intronic
1147674318 17:42194205-42194227 GGAGAAAAGAAGGAAGAGGAAGG + Intronic
1147754677 17:42760824-42760846 GTGGAGAAGAGGGAGGGGGCTGG - Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148712706 17:49693378-49693400 AAGGAAAGGAGGGAGGAGGAAGG - Intergenic
1148863862 17:50618623-50618645 GTGGAATAGAGGGGTGAGGCTGG - Intronic
1149154811 17:53615034-53615056 GTGGAAAGGAGGGAGTGGGAGGG + Intergenic
1149180592 17:53931924-53931946 GTGGAAAAGAGAGAAGAGAGTGG - Intergenic
1149206447 17:54253621-54253643 GTGGAAAAGAGAGAAGAGCGGGG - Intergenic
1149336585 17:55642383-55642405 GTGAAAAAGAGGGAGTGGGATGG + Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149684836 17:58529360-58529382 GAGGAGAAGAGGGGTGGGGAAGG - Intronic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150152235 17:62819559-62819581 GGGGAAAGGAGAGAAGAGGAAGG - Intergenic
1150244581 17:63664814-63664836 GGGAAAAAGAGGAAGGAGGAAGG - Intronic
1150361474 17:64538675-64538697 GTGGGAAGGAGGCATGATGATGG + Intronic
1150520076 17:65857173-65857195 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1150585066 17:66510082-66510104 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1150919544 17:69468740-69468762 GCAGAAAAGAGGGATGATGAAGG - Intronic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151120402 17:71786794-71786816 GTGAAAAAGAGGGATCAGGAAGG - Intergenic
1151144903 17:72031504-72031526 TTGGCAATGAGGGATGAGGGGGG - Intergenic
1151386390 17:73757832-73757854 GAGGAAGAGAGGGAAGGGGAGGG - Intergenic
1152049315 17:77959512-77959534 GTGGAATGGAGGGCTGAAGATGG + Intergenic
1152336715 17:79703100-79703122 GAGGAGGAGAGGGAGGAGGAGGG - Intergenic
1152735451 17:81994861-81994883 GTGTACACGAGGGATGAGGTAGG + Exonic
1152793217 17:82293199-82293221 GAGGGAAGGAGGGAAGAGGAGGG + Intergenic
1152988157 18:338110-338132 GTGGAAAATACAGAGGAGGATGG - Intronic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1153356978 18:4148051-4148073 ATGGAAAAGAGAGACAAGGATGG - Intronic
1153578653 18:6549399-6549421 GAGGAAAAGAGAGAAGGGGAAGG + Intronic
1153692872 18:7610987-7611009 GTGGAAGACAGTGATGTGGATGG + Intronic
1153738204 18:8095176-8095198 GTAGTAAGTAGGGATGAGGATGG + Intronic
1155242355 18:23875847-23875869 GTGGAGATGGGGGATGAGAAGGG - Intronic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1156598979 18:38581423-38581445 GAGGAAAAGAGGGAGGGAGAGGG - Intergenic
1156796638 18:41053897-41053919 GTGAAATAAAGGGATGAGGAGGG - Intergenic
1157163308 18:45335140-45335162 ATGGAAAGGAGGGATGACAAAGG - Intronic
1157301201 18:46481014-46481036 CTGCAAAAGAGGGATCAGAATGG + Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157437858 18:47686494-47686516 GTGGAGAAGAGTGATAGGGATGG - Intergenic
1157470802 18:47986612-47986634 AAGGAAAGGAGTGATGAGGAAGG + Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157795362 18:50569619-50569641 GCGGAAAACAAGGATGAGGAAGG - Intronic
1157813627 18:50715883-50715905 GTGGCAGGGAGGGAGGAGGAAGG - Intronic
1157927456 18:51781816-51781838 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1157931226 18:51825727-51825749 GAGCAAAAGAGGGATGGGGGAGG + Intergenic
1158322965 18:56283333-56283355 GTGGATGAGATGGAAGAGGAAGG + Intergenic
1158351078 18:56565251-56565273 GTGGAAAGGAGAGAAGAGGTGGG + Intergenic
1158396737 18:57084942-57084964 GAGTAAATGAGGCATGAGGATGG + Intergenic
1158927311 18:62281015-62281037 GTAGAAAAGAGGGAAGAGGAAGG - Intronic
1159379873 18:67643391-67643413 GGGGAGAAGAGGGAAAAGGAGGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1159493000 18:69162946-69162968 GGGGAAAGGAGGGAAGGGGAGGG - Intergenic
1159866235 18:73708394-73708416 CTGGCAAACAGGGATGAGAATGG + Intergenic
1160057652 18:75499522-75499544 GAGGAAGAGAGGGAAGATGAAGG + Intergenic
1160077380 18:75691333-75691355 GTGGAAACGAGGGATAGAGAGGG + Intergenic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160254063 18:77232459-77232481 GTGGAAAGGACGGGAGAGGATGG + Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161496008 19:4586056-4586078 AGGGTAAAGAGGGATGAAGAGGG - Intergenic
1162006599 19:7784469-7784491 ATGGTACAGAGGGAGGAGGAAGG - Intergenic
1162021940 19:7872103-7872125 GTGGAGCAGAGGGAGAAGGAGGG + Exonic
1162024192 19:7884522-7884544 GAGGAGGAGAGGGAGGAGGAGGG + Intergenic
1162171753 19:8795251-8795273 GCAGAAAAGAGGGATGAGGATGG - Intergenic
1162173180 19:8807534-8807556 GTGGAACAAAGGGGTGATGAGGG - Exonic
1162339204 19:10081729-10081751 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1162835455 19:13314188-13314210 ATAGAAAGGAGAGATGAGGAGGG + Intronic
1163018542 19:14471054-14471076 GTGGAGATGTGGGATTAGGAGGG - Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163636106 19:18437837-18437859 GTGGACCAGGGGGCTGAGGAAGG - Intronic
1163779705 19:19239901-19239923 GGAGAGAAGAGGGAGGAGGAAGG - Intronic
1164324601 19:24180503-24180525 GAGGAAGAGAAGGAGGAGGAAGG + Intergenic
1164466061 19:28488675-28488697 AAGGAAGAGAGGGAGGAGGAAGG - Intergenic
1164521370 19:28982606-28982628 GTGGAAAGGAAGGATGATGGAGG + Intergenic
1164744239 19:30599398-30599420 GAGGAAAAGAGGAAGAAGGAAGG - Intronic
1164752391 19:30666390-30666412 GTGGAAGGGAGGGAGGAGGCAGG - Intronic
1165707253 19:37985561-37985583 GTGTCTTAGAGGGATGAGGAAGG + Intronic
1165887080 19:39085763-39085785 GAGGAGAAGAGGGATGGAGAAGG - Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166333178 19:42090410-42090432 GGGGAAAAGAGGGAGGAACAGGG + Exonic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1166695362 19:44848682-44848704 GAGGAAAACAGGGAGGGGGAGGG - Intronic
1166996310 19:46721231-46721253 GGGGAGAAGAGGGGAGAGGACGG + Intronic
1167139208 19:47638086-47638108 GAGGAATAGAGGGAGGAGGGAGG - Intronic
1167195167 19:48023374-48023396 GAGGAAAGGAGGGAGGAGGGAGG + Intronic
1167461693 19:49628116-49628138 ACAAAAAAGAGGGATGAGGAAGG - Intergenic
1167666117 19:50823587-50823609 GTGGGCCAGAGGGATGAGGGTGG + Intronic
1167983308 19:53294287-53294309 GCAGAAAAGAGGGTTGAGGAAGG + Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168405943 19:56110790-56110812 GTGGAGAGGAGGGGTGTGGAGGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168663447 19:58184664-58184686 GTAGAAAAGACAGGTGAGGATGG + Intronic
925189956 2:1874807-1874829 GTGGAAATGGGGCAGGAGGATGG - Intronic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925709865 2:6728272-6728294 GTGGAAGAGAGGGAAGGAGATGG + Intergenic
925732985 2:6935480-6935502 CAGGAAAAGAGGCCTGAGGATGG - Intronic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
925862601 2:8194478-8194500 GGGGAGAGGAGGGAGGAGGATGG - Intergenic
925881045 2:8352947-8352969 GAGGAAGGGAGGGAAGAGGAGGG + Intergenic
925902063 2:8515857-8515879 GAGGAAGATAGGGAAGAGGAAGG - Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926337494 2:11875240-11875262 GTGGAGGGGAGGGAAGAGGAGGG - Intergenic
926756778 2:16242918-16242940 GTGGAAATGAGGGAGGAAGAAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927468212 2:23352388-23352410 GTGGAACAAAGGGAGGAGCACGG - Intergenic
927867213 2:26597805-26597827 GTGGAAATGAGGCCTGGGGAAGG + Intronic
927881895 2:26694819-26694841 GTGGAAAAGAGGGAGAGAGAGGG - Intronic
927955651 2:27205661-27205683 GTATAAAAGAGGGATGACGAAGG + Intronic
928102962 2:28450104-28450126 GGGGGAAAGAAGGAGGAGGAGGG - Intergenic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928581133 2:32708767-32708789 GTGGAAAAGGGGGATGAGGAAGG + Intronic
928756282 2:34529509-34529531 GTGGAAAAGGGTGATGGGGAAGG - Intergenic
928771352 2:34705540-34705562 GAGGAAGAGAAGGAGGAGGAAGG - Intergenic
928856956 2:35814047-35814069 GTGGAAATAAGGGATCAGGGGGG - Intergenic
929000668 2:37344643-37344665 GTGGAGAAGAGGGAAGGCGAAGG + Exonic
929021416 2:37557401-37557423 CAGGAAAAGAGGGGTGTGGAGGG + Intergenic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929262391 2:39880302-39880324 GGGGAAAAGAGGGAAAGGGAAGG - Intergenic
929444437 2:41991792-41991814 GGGGAAGAGAGGGAAGGGGAGGG + Intergenic
930158400 2:48128497-48128519 GAGGAAATGGGGGAGGAGGAAGG + Intergenic
930345184 2:50171121-50171143 GAGGAAGAGAAGGAAGAGGAGGG + Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930735685 2:54776208-54776230 GTGGAAAAGGAGGAGGAGAAAGG + Intronic
931132526 2:59353213-59353235 GTGGAAAGAAGTGAGGAGGAGGG - Intergenic
931208205 2:60167862-60167884 GTAGGAAAGAGGGATCAGGAGGG + Intergenic
931624589 2:64245329-64245351 GTGGAAATGGGGGATGGGGAAGG - Intergenic
932014101 2:68006963-68006985 GTGGAAAAGTGAGACCAGGAAGG + Intergenic
932727215 2:74189765-74189787 ATGGAAAAGAAGGAAAAGGACGG + Intergenic
932924317 2:75954305-75954327 GTAGAGAAGAGGGAAGGGGAGGG - Intergenic
933177947 2:79196952-79196974 CTGAAAAAGAGGGATGCTGATGG - Intronic
933262155 2:80142758-80142780 GTGGAAATGAGAGATGCGAAAGG + Intronic
933262182 2:80142934-80142956 GTGGAAAAGAGAGATGAAAAGGG + Intronic
933413395 2:81952777-81952799 GAGGGAAAGAGGGATGACAAAGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933759037 2:85661832-85661854 ATGGAAAAGGGGGATGGGAAGGG - Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935163387 2:100548583-100548605 GCAGAAAAAAGGGATGAGGAAGG - Intergenic
935279653 2:101506452-101506474 GTGGAAGAGGAGGATGGGGAAGG + Intergenic
935443989 2:103137294-103137316 AAGGAAAAGAGGGCTGAGAATGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935863742 2:107362722-107362744 GGAGAAAAGAGGGATCAGGTGGG + Intergenic
935901130 2:107794998-107795020 GTGGGATAGTGGGATGAGGAGGG + Intergenic
936047827 2:109200735-109200757 GTGGGCATGAGGGGTGAGGAGGG - Intronic
936286714 2:111186911-111186933 GTGGTGTAGAGGGATGAGCATGG + Intergenic
936770368 2:115905670-115905692 GTTGAAAAGGGGGATGTGGTGGG - Intergenic
937318153 2:120945073-120945095 GAGGGAAAGAGGGAAGAGGAAGG + Intronic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
939121999 2:138128544-138128566 GTAGAAAAGAGGGAAATGGAGGG - Intergenic
939422837 2:141995911-141995933 GTGGAAAAGAGGGAAGAAAAAGG + Intronic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940678383 2:156752909-156752931 GCAGAAAAGAGGGACGAGGAAGG - Intergenic
940774753 2:157874991-157875013 GGGGAAAGGAGGGGTGGGGAGGG + Exonic
940829458 2:158452257-158452279 GTGGAGAACAGGGGTGAGGGGGG + Intronic
941039195 2:160601141-160601163 GAGGAAAAAAGGGAAGATGATGG - Intergenic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
941873133 2:170406593-170406615 GCAGAAAAGAGGAATGGGGAGGG - Intronic
941943038 2:171063832-171063854 CTCCAAAAGAGGGATGAGGTGGG + Intronic
941980528 2:171451169-171451191 GTAGACAAGAGAGATGAGGGAGG - Intronic
943033914 2:182716626-182716648 GTGAATAACAGGGAGGAGGAAGG - Intronic
943454522 2:188087950-188087972 GTGTAAAAGAAGCATGAGTAGGG + Intergenic
943764626 2:191647428-191647450 GTGTAAAAGTGGGAGGAGCAGGG + Intergenic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
945138831 2:206661535-206661557 GAGAAGAAGAGGGAGGAGGAGGG - Intronic
945459728 2:210091784-210091806 ATGGAAAATTGGGATGAAGAAGG - Intronic
945544950 2:211138774-211138796 TTGGGAAAGAGGTATGTGGATGG + Intergenic
945834510 2:214822774-214822796 GAGGAAGAGAGGAAAGAGGATGG + Intergenic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946079648 2:217106547-217106569 GAGGAAGGGAGGGAAGAGGAGGG - Intergenic
946085046 2:217162481-217162503 GTAGAAAAGAGAGAGGAGAAAGG + Intergenic
946144227 2:217716692-217716714 GCGGGAAATAGGGGTGAGGAAGG + Intronic
946229729 2:218283744-218283766 GTGGCAGGGAGGGTTGAGGAGGG + Intronic
946342810 2:219082497-219082519 GAGGAAAGGAGGGGTGAGGCAGG - Intronic
946717076 2:222563921-222563943 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
946729276 2:222692724-222692746 GAGGACAAGAGAGATAAGGAAGG + Intronic
947092606 2:226529347-226529369 GTGGAAAACAGAGCTGAAGATGG + Intergenic
947154611 2:227149421-227149443 GCAGAAAAGAGAGATGAGGAAGG - Intronic
947220863 2:227791219-227791241 ACAGAAAAGAGGGAGGAGGAAGG + Intergenic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
947718014 2:232351525-232351547 GCGGAAACCAGGGACGAGGAGGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
947962234 2:234248872-234248894 GAGGAAGAGAGCGAAGAGGAAGG - Intergenic
948088239 2:235268132-235268154 GAGGAGAGGAGGGATGGGGAAGG - Intergenic
948301397 2:236909784-236909806 GTGCACACCAGGGATGAGGAGGG - Intergenic
948725336 2:239930656-239930678 GTGGGAAACAGGGAGGTGGAAGG + Intronic
948874124 2:240818367-240818389 CTGGACCGGAGGGATGAGGAGGG - Intronic
948989815 2:241548109-241548131 GGGGTAAAGTGGGAGGAGGATGG - Intergenic
1168904326 20:1391760-1391782 GAAAAAAAGAGGGAGGAGGAGGG + Intronic
1169515662 20:6313111-6313133 GTGGAAAAAAGGGAAAGGGAAGG + Intergenic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169850034 20:10037992-10038014 ATGGTAAAGTGTGATGAGGAGGG + Intronic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170442683 20:16395191-16395213 GGGGAGAGGAGGGAAGAGGAGGG + Intronic
1170879178 20:20279554-20279576 GAGGAAGAGAAGGAAGAGGAGGG + Intronic
1170970980 20:21116376-21116398 GAGGCAAAGAGGGAGCAGGATGG + Intergenic
1170991384 20:21304551-21304573 GTGGAGAAATGGGATGAGAAGGG - Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171158578 20:22899813-22899835 GTGGAGAAGAGAGATCAGGTAGG + Intergenic
1171416215 20:24982411-24982433 GTAGAAAAGCCTGATGAGGAAGG - Intronic
1172105802 20:32516742-32516764 CTGGCAAGGAGGGATGTGGAGGG + Intronic
1172310832 20:33917222-33917244 GAGGAAGAGAGGGATGAGCGTGG + Intergenic
1172326716 20:34041565-34041587 GGGGACAAGAGGGCAGAGGAAGG - Intronic
1172477140 20:35247554-35247576 GTAGAAAAAAGCCATGAGGATGG + Intronic
1172580830 20:36046556-36046578 GTGGAAGAGGGAGAAGAGGAAGG - Intergenic
1172602586 20:36194265-36194287 GGTGACAAGCGGGATGAGGATGG + Exonic
1172632286 20:36386467-36386489 GAAGAAAAGAGGGATGGGGGAGG + Intronic
1172670350 20:36630720-36630742 GAGGCAAAGAGGGATGTTGAAGG - Intronic
1172736345 20:37128709-37128731 GCGGAAAAGAGGTATGAGGAAGG - Intronic
1172869522 20:38127034-38127056 GTGGGAAAGAGGCCTGAGGAGGG + Intronic
1173037256 20:39424377-39424399 GTGGAAATGGGGGATGAGAAAGG + Intergenic
1173201532 20:40958786-40958808 GTGGGAAAGCGGGATGGGGAGGG - Intergenic
1173397741 20:42696262-42696284 GGAGAGAAGAGGGAGGAGGAAGG - Intronic
1173537685 20:43828546-43828568 GTGGAGAAGAGGGAGGAAAAGGG + Intergenic
1173860773 20:46282172-46282194 TTGGCAAAGAGGGAAGAGAATGG + Intronic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174261836 20:49301699-49301721 GGGGAAGAGAGGGATGGGGCAGG - Intergenic
1174832720 20:53827786-53827808 GAGACAAAGAGGGAGGAGGATGG - Intergenic
1174917968 20:54673010-54673032 GTGGAACACTGGGATCAGGAAGG + Intergenic
1175120149 20:56710796-56710818 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120174 20:56710871-56710893 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175120200 20:56710946-56710968 GAGGGAAAGGGGGAGGAGGAGGG - Intergenic
1175244198 20:57571804-57571826 GTTGAAAAGAGAGCTGAGGAAGG + Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175522800 20:59612934-59612956 AAGCAAGAGAGGGATGAGGAAGG + Intronic
1175766072 20:61594010-61594032 GTGGGAGAGAGGGAGGAGGGAGG + Intronic
1175883529 20:62274353-62274375 GTGGATGAGAGGGATGTGGGTGG + Intronic
1176061563 20:63175013-63175035 GCGGACAAGAGGGAGGGGGAGGG + Intergenic
1177758269 21:25373602-25373624 GTGGGAGAGGGGGAGGAGGAGGG - Intergenic
1177767540 21:25475402-25475424 GTGAAAAAGAGGAATGAGCTTGG - Intergenic
1177913262 21:27056839-27056861 TTGGGAAAGAGGTATGTGGATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178142295 21:29698216-29698238 GAGGAACAGAGGGATGAAAAAGG - Intronic
1178363923 21:31972754-31972776 GTGACAAACAGGAATGAGGAAGG + Intronic
1178946101 21:36949073-36949095 GTGGAATGGGGGGATGAGGTGGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179084884 21:38207690-38207712 GGGGAAAGGAGGGGAGAGGAGGG - Intronic
1179208580 21:39306446-39306468 GTGGTAAAGACAGAGGAGGAAGG + Intronic
1179272984 21:39865914-39865936 GTGGGAGAGAAGGAGGAGGAGGG - Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179437954 21:41374973-41374995 GTGAAAAAGAGGGAGGAAAAAGG - Intronic
1179440009 21:41386909-41386931 GTGGAAAAGTGGGATGAGGAAGG - Intronic
1180041198 21:45281127-45281149 GTGGAAAAGGAGGCTGATGATGG - Intronic
1180205414 21:46256394-46256416 GAGGAACAGAGGGATGGGGCGGG + Intronic
1180613822 22:17114595-17114617 GTAGAAAGGAGGGATGCGGGTGG + Exonic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181015101 22:20064098-20064120 GTGGAAGAGAGGGCACAGGAGGG + Intronic
1181333583 22:22113468-22113490 GTGGAAAAGAGGAAGAAGGCAGG - Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181780867 22:25192236-25192258 GTGGAAAGGGGAGGTGAGGAGGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182558557 22:31141942-31141964 GTGGAAAAGGGGGCAGAGGTGGG - Intergenic
1182830261 22:33299319-33299341 GGGGAAAAGAGGGAAGGGAAAGG + Intronic
1183152339 22:36047667-36047689 GTGCTAAGGAGGCATGAGGAGGG - Intergenic
1183525058 22:38317678-38317700 GGGGGACAGAGGGAAGAGGAGGG + Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183878162 22:40802182-40802204 GCAGAAAAGAGGGATGAAGGTGG - Intronic
1184238925 22:43201536-43201558 ATAGAAAAGAAGGAGGAGGAAGG + Exonic
1184348081 22:43925156-43925178 GTGGAAACTAGAGAAGAGGATGG - Intronic
1184437589 22:44488879-44488901 GGGGAAAGGAGGGGAGAGGAGGG + Intergenic
1184437597 22:44488904-44488926 GGGGAAAGGAGAGAAGAGGAGGG + Intergenic
1184449728 22:44575823-44575845 GAGGAAGAGAGGGAGGAGAAAGG + Intergenic
1184717707 22:46291296-46291318 GTGGACAGGAGGGCTGAGGATGG + Intronic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1184901991 22:47452034-47452056 GGGGAGAAGGGGGACGAGGATGG - Intergenic
1184949929 22:47834051-47834073 TTGGAAAAGTGGCAAGAGGAAGG + Intergenic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
1185372518 22:50467635-50467657 GAGGAAGAGGGGGATGAGGGAGG - Exonic
949244236 3:1906631-1906653 GTGGGAAAGAGGGATATGGTAGG - Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949973184 3:9429166-9429188 GTGGAAAAAAGGAATTAGAAGGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950491038 3:13305272-13305294 GGGGAAGAGAGGGAAGGGGAAGG + Intergenic
950610209 3:14121981-14122003 GTGGAGAAGACGGAAGGGGAGGG + Exonic
950626442 3:14250889-14250911 GCGGAAAAGAGGGATGAGGAAGG + Intergenic
950753899 3:15156035-15156057 AGGGAAAGGAGGGAAGAGGAGGG + Intergenic
950789837 3:15462992-15463014 GTGGAAGAGAGGGAGCTGGAAGG + Intronic
951061521 3:18212806-18212828 GTGGAAGAGAGGTAGTAGGAAGG + Intronic
951990135 3:28667578-28667600 ACAGAAAAGAGGGGTGAGGAAGG - Intergenic
952606146 3:35149125-35149147 GGGTAAGAGAGGGATGAGGAAGG - Intergenic
952786194 3:37157560-37157582 GGGGAAAAGAGGAAGGAGGGAGG + Intronic
952798347 3:37263389-37263411 GCGGGAAAGAGGGATGAGGAAGG + Intronic
953042436 3:39267283-39267305 GTGGAAACAAAGGAAGAGGATGG - Intronic
953099377 3:39809924-39809946 GGGGAGAAGAGGGAGGCGGACGG - Intronic
953296215 3:41719988-41720010 TTGGCAAAGAGGGAAGAGAAGGG - Intronic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953902207 3:46849772-46849794 CTGGAAAAGAGGTTGGAGGAGGG + Intergenic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954367556 3:50154664-50154686 GTGGGAATGAGGGACGCGGAAGG + Intergenic
954712451 3:52511919-52511941 GTGGAACAGAGAGACGAGGCTGG - Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
954991533 3:54844562-54844584 TTGGAATAGAGAGATGAGAAGGG - Intronic
955191421 3:56765295-56765317 GCGGAAAAGAGGGATAAGGAAGG + Intronic
955375361 3:58390887-58390909 GTGAAAAAGATAGATGAAGAAGG - Intronic
955615262 3:60800673-60800695 GGGGAAATGAGGGAGTAGGATGG + Intronic
955651683 3:61201591-61201613 ATGGAATAGAGGGATGTGGAGGG - Intronic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
956198835 3:66684146-66684168 GAGGAGGAGAGGGAGGAGGAGGG - Intergenic
956572167 3:70709000-70709022 GTGGAAGAGGGGGAGGAGGTGGG + Intergenic
956741402 3:72279142-72279164 GTGGAAAAGAGAGAAAAGGAAGG + Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
956920754 3:73926730-73926752 TTGGGGTAGAGGGATGAGGAAGG - Intergenic
957652922 3:83032545-83032567 GATGAGAAGAGGGAAGAGGAGGG - Intergenic
957887455 3:86306944-86306966 GTGGGAAATAGGGATATGGAGGG - Intergenic
957944377 3:87043931-87043953 GTGGAAAAGAGGGATGAGAAAGG + Intergenic
958519841 3:95170280-95170302 GGGGAAAAGAGGGTAGGGGAAGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959098214 3:101980490-101980512 GAAGAAAAGAGGGAGGAGAAAGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959550623 3:107651933-107651955 GCAGAAAAGAGGGCTGAGGAAGG + Intronic
959563116 3:107805180-107805202 GGGGAAAAAAAGGATAAGGAAGG + Intronic
959576698 3:107941968-107941990 GTAGGAAAGAGGAATGAGCATGG + Intergenic
959827502 3:110816031-110816053 GTAGAAAAGAGGGCAGAAGAAGG + Intergenic
960049643 3:113227556-113227578 GTGGAAAAGAGGGTTCTGCAAGG - Intronic
960148384 3:114227300-114227322 GGGGAGAAGAGGGTTGAAGAGGG + Intergenic
960157238 3:114308514-114308536 GTGAAAAAATGAGATGAGGATGG - Exonic
960461190 3:117937894-117937916 GTAGAAAAGTGGTATGAGGGTGG - Intergenic
960630819 3:119728812-119728834 GGGGAAAAGAGGGAACAGGTGGG - Intronic
960680633 3:120243906-120243928 GAGGGAAAGGGGGATGAGGAAGG - Intronic
961137369 3:124524287-124524309 AGAGAAAAGTGGGATGAGGAAGG + Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962627064 3:137236290-137236312 GTGGAAAAGTGAGACTAGGAGGG - Intergenic
963044971 3:141095586-141095608 GTGAGAAGGATGGATGAGGAGGG + Intronic
963196971 3:142543399-142543421 GAGGAAAGGAGGGAGGAAGAAGG - Intronic
963510009 3:146235342-146235364 GTGGAAAAGAGAGATGGGAGAGG - Intronic
963963701 3:151340889-151340911 CAGGAAATGTGGGATGAGGATGG + Intronic
964233542 3:154498418-154498440 CCAGAAAAGAGGGATGAGAAAGG + Intergenic
964261912 3:154849023-154849045 GTGGAAAAGGTGGAGAAGGATGG + Intergenic
964261923 3:154849100-154849122 GAAGAGAAGGGGGATGAGGAAGG + Intergenic
964314974 3:155434109-155434131 GTGGAAAATAGTGATGAGAGAGG - Intronic
964384602 3:156133948-156133970 CTGGAAAAAAGTTATGAGGATGG + Intronic
964920748 3:161892567-161892589 GTGGAAAAGGGGAAGGAGAAAGG + Intergenic
965150509 3:164968371-164968393 GTGCAAAAAATGGATGAGGTTGG + Intergenic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
967059487 3:185859388-185859410 GTGGACTAGAGAGATGAGGCTGG - Intergenic
967094738 3:186168055-186168077 GTTGAAAAGAGGAAGGAAGAAGG + Intronic
967112470 3:186306387-186306409 GAGAAAAGGAGGGACGAGGAGGG + Intronic
967293272 3:187942560-187942582 GTGGAGGAGAGGGATGGGAAAGG - Intergenic
967832563 3:193933014-193933036 GAGGAGAAGAGGGGAGAGGAGGG + Intergenic
967895361 3:194391485-194391507 GTGGAAGAGATAGATGAGCATGG + Intergenic
967977484 3:195043698-195043720 GGGGGGAAGAGGGATGGGGATGG - Intergenic
968374216 4:24517-24539 GTGGAAAAGACTAATGATGATGG + Intergenic
968426118 4:524499-524521 GAGAAAGAGAGGGATGAGGAGGG + Intronic
969113751 4:4859314-4859336 GCGGAAAAGAGGGCTGAGGAGGG + Intergenic
969218339 4:5741408-5741430 ATGGAAATGGGGGATGTGGAGGG + Intronic
969403457 4:6972670-6972692 GCGGAAAAGAGGGATGAGGAAGG + Intronic
969495190 4:7522630-7522652 GAGAAAAGGAGGGAGGAGGAGGG - Intronic
969668671 4:8577033-8577055 GCGGAAAAGAGAAAGGAGGAAGG - Intronic
969737765 4:9002397-9002419 ATGTAAAAGAGGGATGTAGAGGG - Intergenic
969832202 4:9806968-9806990 CTGGAAAAGTGGGCTGAGAAGGG - Intronic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
970542761 4:17096025-17096047 GGGGACAAGAGGGGAGAGGAGGG - Intergenic
970542772 4:17096055-17096077 GGGGAAAGGAGGGGAGAGGAGGG - Intergenic
970674100 4:18429189-18429211 GTGGAAAAAAGGTATGAGGTTGG + Intergenic
970730334 4:19095841-19095863 GAGGGAAGGAGGGAGGAGGAAGG + Intergenic
971268571 4:25115849-25115871 GTGGAAAAAGGGTAAGAGGAGGG - Intergenic
971845457 4:31912980-31913002 GTGGAACATAGAGATCAGGATGG - Intergenic
972185568 4:36523861-36523883 GAGGAAGGGAGGGAGGAGGAAGG - Intergenic
972790264 4:42364981-42365003 GGGGAGAAGAGGGAAGTGGAGGG - Intergenic
972807150 4:42540776-42540798 GTGAGACAGAGGGAGGAGGATGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973330889 4:48909322-48909344 GTGGAAAGTAGAGATGAGGGTGG - Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
973671329 4:53221179-53221201 GAGGAAAATAGGGTTCAGGAAGG + Intronic
973687446 4:53386894-53386916 GTGGAAAAGAGGGGTGATAAAGG + Intronic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
973885605 4:55317995-55318017 GAGGAAGAGAGGGAGCAGGAGGG + Intergenic
974061670 4:57041443-57041465 GTTGAAAAGGGTGATGAGGCAGG + Intronic
974194655 4:58557197-58557219 GTGGAAGAGATGGTTGAGTAGGG - Intergenic
974564876 4:63568939-63568961 TTGGGAAAGAGGTATGTGGATGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
974726788 4:65809170-65809192 CTGGAAAACAGGCATGAGAAAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975031453 4:69623158-69623180 GAGGAACAGATGGAAGAGGATGG - Intronic
975036053 4:69684123-69684145 GAGGAACAGATGGAAGAGGATGG + Intergenic
975156076 4:71074586-71074608 AAGGAAAGGAGGGAGGAGGAAGG + Intergenic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
975612027 4:76213250-76213272 GGGTTAAAGAAGGATGAGGAAGG - Intronic
975926570 4:79462225-79462247 GAGAAAGAGAGGGATCAGGATGG + Intergenic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
976124090 4:81815005-81815027 GAGGAAAGGAGGGATGTGGCGGG + Intronic
977031734 4:91892438-91892460 TTGGGAAAGAGGTATGTGGACGG + Intergenic
977093164 4:92704795-92704817 GGAGAAAAGAGGGAAGGGGAGGG - Intronic
977200785 4:94112910-94112932 ATGGAAAAGAGGGAGGGGGAGGG + Intergenic
977578067 4:98695789-98695811 GTGGAAAAGAGATATAAGGAAGG + Intergenic
978728847 4:112001274-112001296 GTGGAAAAGAGAGCTTTGGATGG - Intergenic
978763837 4:112384101-112384123 GTTCAAAAGAGGGATGATAATGG - Intronic
978852070 4:113350735-113350757 GTGCAAAAGAGTGATGGGGGAGG - Intronic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
979239001 4:118431926-118431948 GTGGAAAAGAGGCATTAAGCTGG + Intergenic
979350437 4:119638064-119638086 GAGGAAAAGAGAGAAGCGGAAGG + Intergenic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979733427 4:124052590-124052612 GGGGAAGAGGGGGAAGAGGAGGG + Intergenic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
980896913 4:138868934-138868956 AGGGAAAGGAGGGAAGAGGAAGG + Intergenic
981051720 4:140315815-140315837 GTGGAAAAAAGGCCTGAGGCAGG - Intronic
981278491 4:142929752-142929774 GTGGAAATGAGGCAAGAGAAGGG + Intergenic
981460918 4:145012987-145013009 GAGGAAGAGAGGGAAGAGGGAGG - Intronic
981499079 4:145428104-145428126 GCTTAAAAGAGGGATGAGAAAGG + Intergenic
981600666 4:146485047-146485069 GTGGGTAAAAGGGATGAGGTGGG - Intronic
981728559 4:147873446-147873468 GGGGAAATGAGGGTTGATGAGGG + Intronic
982049652 4:151488046-151488068 GTTGAGAAGAGAGATGATGAAGG - Intronic
982141489 4:152324465-152324487 GTAGGAAAGGGGGAAGAGGATGG + Intronic
982322552 4:154094640-154094662 TTGGAAGAGAGGGATTGGGAGGG - Intergenic
983470939 4:168153343-168153365 GCAGAAAAGAGGGATGGGGAAGG - Intronic
983644638 4:169977390-169977412 GAGGAAGAGAGGGAAGACGAAGG + Intergenic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
984418756 4:179492684-179492706 AGGGAAAAGAGAGAAGAGGAAGG - Intergenic
984968494 4:185164598-185164620 GCAGAAAAGAGAGATGAGGAAGG - Intronic
985331442 4:188841151-188841173 ATGGAAAAGAGAGATGTGGAGGG + Intergenic
985361022 4:189175754-189175776 GTGGAAAGGACACATGAGGAAGG - Intergenic
985460514 4:190101746-190101768 GTGGAAAAGACTAATGATGATGG - Intergenic
985679139 5:1246847-1246869 GGAGGAAAGAGGGAGGAGGAGGG - Intergenic
985734218 5:1568321-1568343 GGGGAAAAGAGAGATCAGGCTGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
985784994 5:1888753-1888775 GAGGAAAAGAAGGATGAGCAAGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985990544 5:3556666-3556688 GGGAAAAAGAGGGATGAATAGGG + Intergenic
986623400 5:9700514-9700536 GCAGAAAAGAGAGATTAGGAAGG + Intronic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
986811046 5:11360174-11360196 GAAGAAAAGAGAGATGAAGAAGG + Intronic
986996101 5:13609247-13609269 GTGGAACTGAGGGGTGAGAAAGG + Intergenic
987220202 5:15783385-15783407 GTGGAAAAAAGGGCTGTCGAAGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
988463597 5:31465756-31465778 GAGGAAGAGAGGGAGGAGGGAGG - Intronic
989062474 5:37423060-37423082 GTGGAAAGAAGTGAAGAGGATGG + Intronic
989308047 5:39980329-39980351 GTGGTAAATAGAGATGAGGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990851466 5:60209716-60209738 GAGGAAAAGAGGGAGAAAGAGGG + Intronic
991088459 5:62670652-62670674 GTGGAAAAGAGGGATATAAAAGG + Intergenic
991261878 5:64676692-64676714 AAGGAAAAGAGGGATGAGGAAGG - Intergenic
992023930 5:72652433-72652455 GTGGAGAAGTGGGACAAGGATGG + Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992507861 5:77405890-77405912 ATAGAAAAGAGAGATGAGGCTGG + Intronic
992579012 5:78151908-78151930 GGGGAGAGGAGGGATGGGGACGG - Intronic
993065619 5:83094381-83094403 GAGGAGAAGAGGGGAGAGGAGGG - Intronic
993227631 5:85187655-85187677 GCAGAAAGGAGAGATGAGGAAGG + Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
993424256 5:87742828-87742850 GTGGAAAGAGGGGAAGAGGAAGG - Intergenic
993926409 5:93871918-93871940 GAGGAAGGGAGGGATGAGAAAGG + Intronic
994170568 5:96655360-96655382 GTGGATAAGAGGGAAAAGGCAGG + Intronic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994781810 5:104098575-104098597 GAGCAAAAAAAGGATGAGGACGG - Intergenic
994974062 5:106779725-106779747 GGGGAGAAGAGGGAAGAGTAAGG + Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
995379810 5:111519072-111519094 GCTGAAAAGAGGGAGGAGGTGGG + Intergenic
995403480 5:111767582-111767604 GTGGAAGAGGGAGTTGAGGAAGG - Intronic
995570666 5:113477658-113477680 GTGGTGCAGAGGGAAGAGGAAGG + Intronic
995883734 5:116870213-116870235 GTGGAAAAGATGGAAAAAGATGG + Intergenic
996845881 5:127898566-127898588 GTGAGAAGGAGGGAGGAGGAAGG + Intergenic
997622890 5:135310873-135310895 GAGGAAAAGAGGGAGGAAGCGGG - Intronic
997691660 5:135831519-135831541 GTGGCATAGGGTGATGAGGAAGG + Intergenic
997893300 5:137694248-137694270 GTGGAAGAGAGGATGGAGGAAGG - Intronic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998397925 5:141831393-141831415 GTGGTATAGAGGGGTGAGGGAGG + Intergenic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
999233630 5:150077719-150077741 TTGGGAGAGAGGGAGGAGGAGGG - Intronic
999261538 5:150241669-150241691 GTTGAGGAGAGGGAAGAGGAAGG - Intronic
999482320 5:151960031-151960053 GTGAAAAAGAGGGATGAGGGAGG + Intergenic
999679670 5:154045056-154045078 AAGGACAAGAGGGATGGGGAAGG - Intronic
1000268949 5:159664726-159664748 GTGGAAAAGGAGCATGAGGGAGG - Intergenic
1000294110 5:159898020-159898042 GGGGAAGAGAGGGAAGGGGATGG - Intergenic
1000462953 5:161545635-161545657 GTGGGAAAGACTGAGGAGGAGGG - Intronic
1000484363 5:161821652-161821674 GAGAGAAAGAGGGATGAGTAGGG - Intergenic
1000631578 5:163596540-163596562 GTTCAAGAGAGGGATGATGAGGG - Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1001275936 5:170351588-170351610 GTGGAATTGAGGCATGAGGCAGG - Intergenic
1001310063 5:170604102-170604124 GTGGGAACCAGGGAAGAGGAGGG + Intronic
1001312123 5:170618532-170618554 GAGGAAAGGAGGGAGGAGGGAGG + Intronic
1001334947 5:170789367-170789389 TTGGCAATGATGGATGAGGATGG + Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001817085 5:174678692-174678714 GCCAAAAAGAGGGATGAGGAAGG + Intergenic
1001938787 5:175726815-175726837 GTGGAAGACAGGGAGGAGGGAGG + Intergenic
1002483918 5:179522300-179522322 GTGGGAAGGAGGGATCCGGAAGG + Intergenic
1002500645 5:179645181-179645203 GTGGGAAGGAGGGATCCGGAAGG - Intergenic
1002739250 5:181422524-181422546 GTGGAAAAGAGGCATTAAGCTGG + Intergenic
1002742368 5:181443078-181443100 GGGGAGAAGAGAGATAAGGAGGG + Intergenic
1002893471 6:1357748-1357770 GTTGAAAAGGAGGAAGAGGAGGG - Intergenic
1002904138 6:1435232-1435254 GTTGTAAAGAGGGAAGTGGAAGG + Intergenic
1003020375 6:2504631-2504653 GGGGTAAGGAGGGGTGAGGAGGG - Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003232506 6:4267445-4267467 GAGGAAGAGAGGGAAGAGGAGGG + Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003407775 6:5837822-5837844 GTGGAAAACAGGGACAAGGCTGG + Intergenic
1003690523 6:8349195-8349217 GTGGAAAGAAGAGATAAGGAGGG - Intergenic
1004188990 6:13447881-13447903 GAGGCACAGAGGGCTGAGGAGGG + Intronic
1004211625 6:13651906-13651928 GTGGTAGAGAGGAGTGAGGAGGG - Intronic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1004362757 6:14985811-14985833 GTGGCAAATAGGGATGGGGAGGG - Intergenic
1004577416 6:16910541-16910563 GTGGAAGAGAGGGAGGATCAGGG - Intergenic
1005070922 6:21861571-21861593 GTGGAAGAGATGGAAGAGGGAGG + Intergenic
1005419260 6:25631912-25631934 GTGCAAAAGAGGGATGACTAGGG + Intergenic
1005630226 6:27700340-27700362 GAGGGAAAGAGGGATGGGGTGGG - Intergenic
1005673926 6:28134897-28134919 GTGGCAAGGAGGGAAGGGGAAGG - Intergenic
1005849062 6:29805342-29805364 GAGGAACAGAGGGAGTAGGAAGG - Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006001637 6:30969703-30969725 GTGGGAAAGAGTTATGTGGATGG + Intergenic
1006340349 6:33443329-33443351 GTGGAAGAGAGGGTTCTGGAAGG - Exonic
1007162890 6:39806628-39806650 GAGGAAAGAAGGGTTGAGGATGG - Intronic
1007577774 6:42937283-42937305 GCCTAAAAGAGGGAAGAGGAAGG + Intronic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1007995812 6:46306497-46306519 ATGGTAAGGAGAGATGAGGAGGG + Intronic
1008228936 6:48959749-48959771 GGGGAAGAGAGGGAAGGGGAGGG - Intergenic
1008554696 6:52663597-52663619 GCTGAAAAGAGGGATGAGGAAGG + Intergenic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1010744371 6:79544119-79544141 ACAGAAAAGAGGGATGAGGAAGG - Intergenic
1010904262 6:81467330-81467352 GTGGCAAAGAGTGATAAGCAAGG + Intergenic
1011361322 6:86527949-86527971 GTGGAGTAGAGGGAGGGGGAGGG - Intergenic
1011821832 6:91262113-91262135 GGGGACAAGAGGGAGTAGGAAGG + Intergenic
1011958684 6:93057749-93057771 AAGGAAAAGAGGGATGGGAAGGG + Intergenic
1012271841 6:97222695-97222717 ATGAAAAAGGGGGATGGGGAGGG + Intronic
1012526274 6:100181840-100181862 GAGGAAAAAAGAGATGGGGAGGG - Intergenic
1012678881 6:102153749-102153771 GAAGAAAAGAGGGAAGAGGGGGG + Intergenic
1013049404 6:106517624-106517646 GGGGAAAGTAGGGATGAGGATGG - Intronic
1013609187 6:111778251-111778273 GAAGAAAAGATGAATGAGGAAGG + Intronic
1013986890 6:116205136-116205158 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015017591 6:128433247-128433269 GTGGAAAGCGGGGATGAAGAGGG - Intronic
1015335109 6:132028002-132028024 GCGGAAGAGAGAGATGAGGAAGG + Intergenic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015583358 6:134750524-134750546 GTGGGAAGGAGTGCTGAGGATGG + Intergenic
1015658457 6:135546548-135546570 GGGGAAAAGAGGGAACAGGGAGG + Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016161311 6:140883960-140883982 AGGGAAAAGAGGGAGGAGAAAGG - Intergenic
1016466611 6:144331839-144331861 GTGGTAGAGAGGAATGTGGAAGG + Intronic
1016758595 6:147713896-147713918 TAGGAAGGGAGGGATGAGGAAGG - Intronic
1017503500 6:155046739-155046761 GAGGCACAGAGGGATCAGGAGGG - Intronic
1017521944 6:155210133-155210155 TTGGAGAAGAGTGCTGAGGATGG + Intronic
1017570754 6:155741999-155742021 GGGGTGAAGAGGGATGAGAATGG - Intergenic
1017797826 6:157863708-157863730 GTAGACAAGAGGGGTGAGAAGGG + Intronic
1018543924 6:164914747-164914769 GTGGAAAAGAGAGACAGGGAAGG + Intergenic
1018728907 6:166634413-166634435 GTAAAATGGAGGGATGAGGAAGG - Intronic
1019148896 6:169991252-169991274 AAGGAAAAGAGGGAGGTGGAGGG + Intergenic
1019206410 6:170365662-170365684 GTGGTAGAGAGGCATGAGCACGG + Intronic
1019244360 6:170698083-170698105 GTGGAAAAGAGGCATTAAGCTGG + Intergenic
1019302841 7:317394-317416 GGGGAAAAGTGGGATGAGCCTGG - Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1020481051 7:8661525-8661547 GCAGAAAAGAGGGGAGAGGAAGG + Intronic
1020800922 7:12731201-12731223 GAGGAGACGAGGAATGAGGAGGG - Intergenic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1021128361 7:16880540-16880562 GGGGAAAGGAGGGGAGAGGAGGG - Intronic
1021128373 7:16880570-16880592 GGGGAAAGGAGGGGAGAGGAGGG - Intronic
1021343426 7:19491458-19491480 TTACAAAAAAGGGATGAGGAGGG - Intergenic
1021445823 7:20732319-20732341 GGGAAAGAGAGTGATGAGGAGGG - Intronic
1021697105 7:23286298-23286320 GGGGAAGAGAGGGGGGAGGAAGG - Intergenic
1022113276 7:27244079-27244101 GTGGAGAAGTGGGACTAGGAAGG - Intronic
1022311443 7:29200334-29200356 GAAGAAAAGAGGGAGGGGGAGGG - Intronic
1022374047 7:29796945-29796967 GTGGAGAAGAGTTAGGAGGAGGG + Intergenic
1022435835 7:30384121-30384143 GCAGAAAAGAGGGATGAGGAAGG - Intronic
1022466507 7:30656030-30656052 ATGGGAAAGAGGGAAAAGGAAGG + Intronic
1022476996 7:30717527-30717549 GAGGAAAAGAGGGAGGGAGATGG + Intronic
1022627177 7:32049474-32049496 GAATAAAAGAGGGATGAGGAAGG + Intronic
1022633016 7:32103367-32103389 GTGGAAAGTAGGGGTGAGGATGG + Intronic
1022685695 7:32594144-32594166 GGGGAAAAGAGTGATGAGAGAGG + Intergenic
1022816882 7:33922569-33922591 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023089128 7:36601351-36601373 GAGGAAAAGAGGGAGGGAGAGGG + Intronic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1023420542 7:39974923-39974945 GTTGAACAGAGGAATGAGAAGGG + Intronic
1023706376 7:42945948-42945970 GCAGAAAAGAGGGATGAGGAAGG + Intronic
1023740552 7:43277448-43277470 GCAGATAAGAGGGATGAGGAAGG + Intronic
1023809671 7:43902115-43902137 GAGGAGGAGAGGGAGGAGGAGGG + Intronic
1023816605 7:43955305-43955327 GTGGACAAGAGTGATCAGAAAGG + Exonic
1024669772 7:51583977-51583999 GTGGAAGACAGAGAAGAGGAGGG + Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1024821446 7:53335412-53335434 GTGGGAGAGAGGGATAAAGATGG + Intergenic
1024924390 7:54598035-54598057 GCGGAAAAAATGGATGAGGAAGG - Intergenic
1025096669 7:56100998-56101020 GTGGAAAAGAGCGATGAGGAAGG - Intergenic
1025121372 7:56306841-56306863 GTGGAAAAAAGGGATAAGGAAGG + Intergenic
1026044203 7:66894573-66894595 AGGGAAGAGAGGGAGGAGGAAGG + Intergenic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026159090 7:67852942-67852964 GAGGAAGAGAAGGAGGAGGAGGG + Intergenic
1026228433 7:68462872-68462894 GGGGAAGAGAGGGAAGGGGAGGG - Intergenic
1026380661 7:69796219-69796241 GTTGAAAATAGGGAAGAGGCTGG + Intronic
1026567533 7:71501791-71501813 GTGAGAAAGAGGGAGAAGGAAGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1028066344 7:86390024-86390046 GTGGAAAAGAGAGAGAGGGAGGG - Intergenic
1028086607 7:86644541-86644563 GTAGAAGAGAGGGAGGAGGTTGG - Exonic
1028114257 7:86979895-86979917 GTGGAAAAAAGAGATGAGAAAGG - Intronic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028751666 7:94390225-94390247 GTGGAAAAGAGGGAGGATAGAGG - Intergenic
1028794289 7:94886464-94886486 GAGGAAGAGAGGGAGGGGGAGGG - Intergenic
1028887681 7:95952491-95952513 GGGGATAAAAGGGATGGGGAGGG - Intronic
1029519692 7:101052186-101052208 GTGCTAAGGAGGGCTGAGGAAGG + Intronic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029630473 7:101747228-101747250 GCGGAAAAGAGGGATGAGGAAGG - Intergenic
1030380027 7:108800896-108800918 GGGGAGAAGAGGGGAGAGGAGGG - Intergenic
1030608004 7:111659149-111659171 TGGGAAAATAGGGAAGAGGAAGG - Intergenic
1031072668 7:117179634-117179656 TTAGAGCAGAGGGATGAGGAGGG + Intronic
1031080821 7:117255365-117255387 GTAGAACAGAGGGAAGAGGTTGG + Intergenic
1031188138 7:118509947-118509969 GTGCAAATGAGAGATGATGATGG + Intergenic
1031482044 7:122289796-122289818 GTGAGAAAGAGGGAGGAGCAAGG + Intergenic
1031824649 7:126548165-126548187 GTGGGGTGGAGGGATGAGGAGGG + Intronic
1031917743 7:127578917-127578939 GGGGAAAAGGGGGATGAGGGGGG + Intergenic
1032023168 7:128421373-128421395 GTGGGAGAGAGGGAGGAGAAGGG + Intergenic
1032165214 7:129539922-129539944 ATAGGAGAGAGGGATGAGGAGGG + Intergenic
1032217497 7:129968970-129968992 ATGGAAAAGAGAGAGGAGGCCGG + Intergenic
1032746312 7:134790130-134790152 AGGGAAAAGGGGGAAGAGGAGGG + Intronic
1033683407 7:143618720-143618742 GGGGAAAAGAGGGATGAGGAAGG + Intergenic
1033701206 7:143838918-143838940 GGGGAAAAGAGGGATGAGGAAGG - Intergenic
1033733995 7:144204553-144204575 TTGGAAGATAGGGATGGGGATGG + Intergenic
1033749056 7:144346420-144346442 TTGGAAGATAGGGATGGGGATGG - Intergenic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1033977427 7:147119026-147119048 GAGGAAAAGAAGGAAGAGCAGGG + Intronic
1034065808 7:148135871-148135893 GGGGAAGGGAGGGATGGGGAAGG + Intronic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034431691 7:151044240-151044262 GTGGATCAGTGGGTTGAGGATGG + Intronic
1034867002 7:154650343-154650365 GTGGAGAGGAGGGCAGAGGAGGG + Intronic
1034911215 7:155000508-155000530 GAGGAAGAGAGGGCTGGGGAGGG - Intronic
1035280841 7:157776907-157776929 GAGGAGAAGAGCGAGGAGGAGGG - Intronic
1035368783 7:158365379-158365401 GGGGAAGGGAGGGGTGAGGAAGG - Intronic
1035389458 7:158495909-158495931 GAGGGAGAGAGGGAGGAGGAAGG + Intronic
1035503765 8:110089-110111 GTGGAAAAGAGGCATTAAGCTGG - Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035737702 8:1900835-1900857 GAGGCAAGGAGGGAGGAGGACGG - Intronic
1035775564 8:2185065-2185087 AGGGAAAAGAGGGAAGAGGCAGG + Intergenic
1035776313 8:2191311-2191333 GAGGAAGGGAGGGAGGAGGAAGG - Intergenic
1035776323 8:2191337-2191359 GAGGAAGGGAGGGAGGAGGAAGG - Intergenic
1035776329 8:2191352-2191374 GAGGAAGGGAGGGAGGAGGAAGG - Intergenic
1035776335 8:2191367-2191389 GGGGAAGGGAGGGAGGAGGAAGG - Intergenic
1035898468 8:3431504-3431526 CTGGAAAAAAGGCATGGGGATGG - Intronic
1035910986 8:3566205-3566227 GAGGAGGAGAGGGAAGAGGAAGG + Intronic
1035960816 8:4135374-4135396 GTGGGAAAGAGGGGGAAGGAAGG + Intronic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1036665389 8:10734059-10734081 GAGGAGAAGAGGGAGGAAGAGGG + Intronic
1037178352 8:15973622-15973644 GGGGAGGAGAGGGAGGAGGAAGG + Intergenic
1037540461 8:19865661-19865683 GAGGGAAAGAGAGATAAGGAAGG + Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1037802368 8:22042754-22042776 AGAGAAAAGAGGGAGGAGGAGGG - Exonic
1037924030 8:22830690-22830712 GAGGAAAAGAGGGAGGAACATGG - Intronic
1037927411 8:22854849-22854871 TTTGAAAAGAGGGAGGGGGAGGG - Intronic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038208281 8:25490379-25490401 GAGGAGGAAAGGGATGAGGAGGG + Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1039405391 8:37308283-37308305 GAGGAAGAGAGAGATGAGGGAGG + Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039468788 8:37801270-37801292 GTGGGACAGAGGGATCAGGAAGG - Intronic
1039600530 8:38833243-38833265 GCGGAAAAGAGGGATGAGGAAGG + Intronic
1039822762 8:41148189-41148211 GAAGAAGAGAGGGAGGAGGAGGG + Intergenic
1041572512 8:59353248-59353270 GTGGAAAAGTGGAATGAGAAGGG + Intergenic
1041647416 8:60267577-60267599 GCAGAAAAGCGGGATGAAGAGGG + Intronic
1041669087 8:60475277-60475299 GAGGAAGAGGTGGATGAGGAAGG - Intergenic
1041852661 8:62410090-62410112 GGGGAAGGGAGGGAGGAGGAGGG - Intronic
1042089651 8:65144868-65144890 GTTGAAAAGAGGAAGAAGGAAGG - Intergenic
1042284539 8:67093624-67093646 GTGGAAAAGAGTACTGAGGTAGG + Exonic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042708763 8:71691494-71691516 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1042781102 8:72491900-72491922 GAGGGAAGGAGGGAGGAGGAAGG + Intergenic
1042939472 8:74092600-74092622 GTGGAAGAGAGGGATGGAGGAGG - Intergenic
1042984543 8:74568403-74568425 CTGGAAAAGAGGGATGAGGAAGG - Intergenic
1043208679 8:77481941-77481963 GTGGAAAAGATATATGAAGAGGG + Intergenic
1043243489 8:77967407-77967429 ATGGAAAAGAGGTGGGAGGAGGG + Intergenic
1043379557 8:79687996-79688018 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044381514 8:91539618-91539640 GGGGAAAAGAGAGATGAGGGAGG - Intergenic
1044386950 8:91600314-91600336 GGGGAACAGAGTTATGAGGAGGG + Intergenic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045033718 8:98161611-98161633 GGGGAAAGGAGGGGAGAGGAGGG - Intergenic
1045130393 8:99145462-99145484 CTGGAAAAGAGGGAGGAGAAAGG - Intronic
1045905373 8:107338447-107338469 GTGGAACAGGAGGGTGAGGAGGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046808255 8:118504084-118504106 CAGGAAAAGAGGGAAGAGTAAGG - Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047214989 8:122869095-122869117 GAGGACAAGAGAGAAGAGGAGGG - Intronic
1047389271 8:124437024-124437046 GGGGAAATGAGAGATGAGAAAGG + Intergenic
1047389290 8:124437118-124437140 GGGGAAATGAGGGATGAGAAAGG + Intergenic
1047398399 8:124524913-124524935 GGGGAAATGAGGGATGAGAAAGG + Intronic
1047461517 8:125070120-125070142 GAGGAAATAAGGGATGAGAAAGG - Intronic
1047475687 8:125226722-125226744 GTGGAAAAGAGGTAGAAGCAGGG + Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1047994192 8:130317896-130317918 GTGGAGAGGAGAGCTGAGGAAGG + Intronic
1048007678 8:130432139-130432161 GGGGAACAGAGGCAGGAGGAGGG + Intronic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1048073030 8:131040936-131040958 GGGGCAAAGAAGGAGGAGGAGGG + Exonic
1048262796 8:132959920-132959942 GCAGAAAAGAGTGATGAGGAAGG + Intronic
1049169215 8:141148237-141148259 GTGGAAAGGAGGGAGGAGGGAGG + Intronic
1049231775 8:141488439-141488461 GGGGGAAGGAGGGAGGAGGAAGG - Intergenic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050430606 9:5558123-5558145 GGGGAAAAGAGGGGTGAAAATGG - Intronic
1050588797 9:7141250-7141272 TGGGAAAAGAGGGATGAGAAAGG - Intergenic
1050707200 9:8414887-8414909 GAGGGAGAGAGGGATGGGGAGGG + Intronic
1051370962 9:16358684-16358706 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1053054756 9:34987930-34987952 GAGGAAAGGAGGGCTGGGGAGGG - Intergenic
1053329277 9:37188732-37188754 GGGGAAGAGAGGGGTGAGGAAGG - Intronic
1053608688 9:39687278-39687300 GCAGAAAAGAGGAAGGAGGAAGG - Intergenic
1054244836 9:62655132-62655154 GCAGAAAAGAGGAAGGAGGAAGG + Intergenic
1054558962 9:66689663-66689685 GCAGAAAAGAGGAAGGAGGAAGG + Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054920155 9:70535691-70535713 GGGGAAGAGAGGGAGAAGGAAGG - Exonic
1054936254 9:70691930-70691952 GAGGAAAAGAGGGATGAGGAAGG - Intronic
1055078876 9:72246941-72246963 GCAGAAAAGAGGGATGAGGGAGG - Intronic
1055316551 9:75039837-75039859 GGGGAAGAGAGGGAAGAGGAAGG - Intergenic
1055559735 9:77510839-77510861 GGGGAAAAGAGGGAAGACGCTGG + Intronic
1055660898 9:78502957-78502979 CTGGAAAAAAGGGCTGTGGAGGG + Intergenic
1055720789 9:79171881-79171903 GTGGAGTGGAGGGAGGAGGATGG + Intergenic
1055987258 9:82063897-82063919 GTGGGAAGGAGGGATCTGGAAGG - Intergenic
1056388306 9:86117448-86117470 GGGGTAAAGAAGGAAGAGGAGGG + Intergenic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1057354001 9:94320596-94320618 GAGGCAGAGAGGGAGGAGGATGG + Intronic
1057493347 9:95540091-95540113 GTGGAGAAGAGAGAAGCGGAAGG - Intergenic
1057497998 9:95575304-95575326 GAGGAGAAGAGGGAGGAAGAAGG + Intergenic
1057653764 9:96937039-96937061 GAGGCAGAGAGGGAGGAGGATGG - Intronic
1057802147 9:98197130-98197152 GAGAAAAAGGGGGATGAGGGAGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058349399 9:104003421-104003443 GTGGAAAAGGGAGAAGAGGAAGG + Intergenic
1058563045 9:106250141-106250163 GAGGAAGAGGGGGAGGAGGAGGG - Intergenic
1058822424 9:108744922-108744944 GGGGAAGGGAGGGATGAAGATGG - Intergenic
1059354234 9:113687092-113687114 GAGGAAAGGAGGGAGGAGGAGGG + Intergenic
1059354274 9:113687215-113687237 GGGGAAGGGAGGGAGGAGGAAGG + Intergenic
1059354308 9:113687348-113687370 GGGGAAAGGAGGGAAGAGGGAGG + Intergenic
1059507245 9:114810766-114810788 GTGCAAATGAGGGATTAGCAAGG + Intergenic
1059712408 9:116881125-116881147 GTGGAAGAGGAGGAGGAGGAAGG + Intronic
1059767211 9:117394978-117395000 GTGGAAACGAGGAAAGAGCATGG + Intronic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1060108695 9:120891254-120891276 GGGGAAAGGAGGGGAGAGGAGGG - Intronic
1060278585 9:122200507-122200529 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1060472448 9:123959513-123959535 GTGGGAAAGAGGAATTTGGATGG - Intergenic
1060528657 9:124334735-124334757 GTGGAAAAGCGGGCTGGGGCTGG + Intronic
1060566509 9:124597382-124597404 GTGGAAAAAATGGAAGGGGAAGG + Intronic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060765351 9:126291650-126291672 GTGGGGAAGAAGGATCAGGAGGG - Intergenic
1060793118 9:126498807-126498829 GTGGGAAGGAGGGAGGAGGCTGG + Intronic
1061081325 9:128372244-128372266 GTGGAAAAGAGGAAATAGGTAGG + Intronic
1061255672 9:129453395-129453417 ATGGAGTAGAGGGATGGGGATGG + Intergenic
1061282015 9:129602870-129602892 GAGGAAAGGAGAGAGGAGGAGGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061658576 9:132112019-132112041 GATGAAGGGAGGGATGAGGAAGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062219737 9:135408762-135408784 GTGCAACACAGGGAAGAGGAAGG + Intergenic
1062421114 9:136483204-136483226 GCGGGACAGAGGGATGAGGCGGG - Intronic
1062523584 9:136969555-136969577 GTGGAAATGTGGGCTGAGGGTGG - Intronic
1062560229 9:137138374-137138396 GTGGACCAGAGGGATGGGTAAGG + Intronic
1203446832 Un_GL000219v1:64533-64555 GAGGAAAAGAGAGAGGGGGAAGG - Intergenic
1203604548 Un_KI270748v1:47309-47331 GTGGAAAAGAGGCATTAAGCTGG + Intergenic
1203608277 Un_KI270748v1:74297-74319 GGGGAGAAGAGAGATAAGGAGGG + Intergenic
1185499183 X:584483-584505 GAGGAAAAAGGGGAGGAGGAGGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185608548 X:1380684-1380706 GAGGAAAAGGGGGAGGAAGAGGG + Intronic
1185683827 X:1910698-1910720 GAGGAAGAGAGGGAGGAAGAGGG - Intergenic
1185913542 X:4009017-4009039 GTGGAAAAGAGAGATAAGGAAGG + Intergenic
1186206328 X:7204657-7204679 GAGGAAAAAAGGAAGGAGGAAGG - Intergenic
1186268014 X:7852497-7852519 GAAGAAAAGAGGGATGAGAAGGG + Intergenic
1186355788 X:8788270-8788292 GTGTAAAAGAGGCAGGAGAAAGG + Intergenic
1186377524 X:9020392-9020414 GTGTAAAAGAGGCAGGAGAAAGG + Intergenic
1186386019 X:9110855-9110877 ATGGAAAACATGGATGATGACGG + Intronic
1186581506 X:10824807-10824829 GTGTATGGGAGGGATGAGGATGG - Intronic
1186598782 X:11013561-11013583 GTGGGAGAGAGGGTAGAGGAGGG + Intergenic
1187071350 X:15892017-15892039 GAGGAAAAGAGAGATGGGGGAGG + Intergenic
1187110053 X:16288783-16288805 GAGGGAAAGAGGGAGGAAGAGGG - Intergenic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1187480517 X:19650768-19650790 GGGGAAAAAAGGCAGGAGGATGG + Intronic
1188146544 X:26620840-26620862 GGGGAAAAGGGTGAGGAGGATGG + Intergenic
1188598092 X:31925982-31926004 GAGGAAGAGAGTGATGATGATGG + Intronic
1188822670 X:34794648-34794670 GTGTAAGAAAGGGATGTGGAGGG + Intergenic
1188874925 X:35417881-35417903 GTGAAAAAGAGGTATGTGGCAGG + Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189112208 X:38303093-38303115 GTTGAAAAGAAGGAGGAAGAAGG - Intronic
1189141962 X:38616532-38616554 GCGGAAAAGAGGGATGAGGAAGG - Intronic
1189286099 X:39853580-39853602 ATGGAAAGGGGGGAAGAGGAGGG + Intergenic
1189286122 X:39853676-39853698 GGGGGAAAGAGAGAAGAGGAAGG + Intergenic
1189321167 X:40088457-40088479 GGGAAAAAGAGGGAGGAGGAGGG + Intronic
1189415108 X:40806055-40806077 GTGGCAGAGAGAGAAGAGGAGGG - Intergenic
1189684721 X:43551971-43551993 GTGGAAAACAGAGAGGAGGCAGG - Intergenic
1189830358 X:44966687-44966709 GTGTAATAGGGGGAAGAGGAAGG + Intronic
1189947082 X:46190468-46190490 GAGAAGAAGGGGGATGAGGAGGG - Intergenic
1190141586 X:47850610-47850632 GAGGGAAAGAGGCATGAGTAAGG + Intronic
1190576716 X:51846712-51846734 GTGGAAGAGAGAGAGGGGGAAGG + Intronic
1190716843 X:53111745-53111767 GCAGAAAAGAGGGATGAGGAAGG - Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1192130117 X:68541900-68541922 ATGGAAAAGTGGGGTGTGGAGGG - Intergenic
1192433438 X:71127670-71127692 GAGGAAAAGGGGGAAGAGGGTGG - Intronic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192558292 X:72107745-72107767 GTGGAAAAGAGGGCAGGGGTGGG + Intergenic
1192747180 X:73950825-73950847 GTGGAAAAGATGGAGGAGGCAGG + Intergenic
1192756967 X:74056523-74056545 GAGGAATACAGGGAGGAGGAAGG - Intergenic
1192838493 X:74828062-74828084 ATGGAAACAAGGGATGAAGATGG + Intronic
1193023122 X:76814079-76814101 GAGGAAAAGAGGGCCAAGGAAGG - Intergenic
1193247103 X:79242205-79242227 GAAGAAAAGAGGGAGGAAGAAGG - Intergenic
1193925274 X:87476592-87476614 GCAGAGAAGAGGGAAGAGGAGGG - Intergenic
1195570875 X:106397432-106397454 GAGCAAAAGAGAGATGAGGGAGG - Intergenic
1195782267 X:108479237-108479259 TTGGGAAAGAGGTATGTGGATGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196397508 X:115280878-115280900 GCAGAAAAGAGGGATGAGGAAGG + Intergenic
1197105481 X:122708798-122708820 TTGGATAAGAGTGATGAGTATGG - Intergenic
1197174434 X:123470206-123470228 AAGGAAATGAGGGAGGAGGATGG + Intronic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197683900 X:129417550-129417572 GTGGAAAGGAGGGAGGGGAATGG + Intergenic
1198139501 X:133788686-133788708 GAGGAGGAGAGGGAGGAGGAGGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1198704386 X:139432790-139432812 GTGGAGAGGAGGGAAAAGGAAGG - Intergenic
1199259845 X:145759716-145759738 GCGTAAAAGAGGGATATGGAGGG + Intergenic
1199333246 X:146586563-146586585 GGGGAAAAGAGAGAGGGGGAAGG - Intergenic
1199453686 X:148002763-148002785 GTGAGAAAGAAGGATAAGGAAGG + Intronic
1199535269 X:148895595-148895617 GTGTAAGAGAGGGAGGGGGAGGG + Intronic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199972974 X:152874086-152874108 GAGAAAAGGAGGGAAGAGGATGG + Intergenic
1199982788 X:152929917-152929939 GTGGAACAGAAAGATGAAGAGGG - Intronic
1200795078 Y:7333498-7333520 GTGGAAGAGAGGGGAGGGGAGGG - Intergenic
1201300187 Y:12498531-12498553 AGGGAAGAGAGGGAGGAGGAAGG - Intergenic
1201343343 Y:12956957-12956979 GAGGAAGAGAGAGAGGAGGAAGG + Intergenic
1201935567 Y:19407366-19407388 GTGGAAAAGAGTAATGATGTAGG + Intergenic
1202076039 Y:21038835-21038857 GAGGAAGAGAGGGATTAGGCTGG + Intergenic
1202386759 Y:24333722-24333744 GTGGAAAAGAGGCATTAAGCTGG + Intergenic
1202484026 Y:25336406-25336428 GTGGAAAAGAGGCATTAAGCTGG - Intergenic