ID: 1159471852

View in Genome Browser
Species Human (GRCh38)
Location 18:68867456-68867478
Sequence CTCTGTGGCCTGCATCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159471845_1159471852 1 Left 1159471845 18:68867432-68867454 CCCTGAGACAGTGGAAACTGCCA No data
Right 1159471852 18:68867456-68867478 CTCTGTGGCCTGCATCCTGGGGG No data
1159471844_1159471852 7 Left 1159471844 18:68867426-68867448 CCTTCTCCCTGAGACAGTGGAAA No data
Right 1159471852 18:68867456-68867478 CTCTGTGGCCTGCATCCTGGGGG No data
1159471846_1159471852 0 Left 1159471846 18:68867433-68867455 CCTGAGACAGTGGAAACTGCCAG No data
Right 1159471852 18:68867456-68867478 CTCTGTGGCCTGCATCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159471852 Original CRISPR CTCTGTGGCCTGCATCCTGG GGG Intronic