ID: 1159474784

View in Genome Browser
Species Human (GRCh38)
Location 18:68906529-68906551
Sequence TATACTCATCCCAGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159474784 Original CRISPR TATACTCATCCCAGTGGGTT TGG Intronic
900897109 1:5491098-5491120 TATACTCATGCCTGTGTGTTTGG - Intergenic
907105778 1:51881262-51881284 TATAGTAATCCCAGTGATTTGGG - Intergenic
909798698 1:79778166-79778188 TAAACCCTTCCCATTGGGTTGGG + Intergenic
917681060 1:177368031-177368053 TATATTTATCTCAGTGGTTTGGG + Intergenic
922589305 1:226762315-226762337 TATACTCATTCCAATGTGGTAGG + Intergenic
924041304 1:239986357-239986379 TATAGCCATCCCAGTGGGTGTGG + Intergenic
1064935482 10:20674248-20674270 TGTCCTCAACCCAGTGGGGTTGG - Intergenic
1069644607 10:69984512-69984534 TATAGCCATCCTAGTGGGTGTGG - Intergenic
1070399560 10:76041542-76041564 TAAAATCATCCCAGTGGTTATGG + Intronic
1071719102 10:88124902-88124924 TATAGCCATCCTAGTGGGTATGG - Intergenic
1073272801 10:102280454-102280476 TAGCCTGATCCTAGTGGGTTGGG + Intronic
1075391297 10:122094536-122094558 TATAATAATCCCAGTGCTTTAGG - Intronic
1076465593 10:130679380-130679402 GTTCCTCATCCCAGTGCGTTGGG - Intergenic
1079675509 11:23221397-23221419 AATACTCAGCCCAGTGAATTAGG + Intergenic
1083348123 11:62008177-62008199 TATAGCCATCCTAGTGGGTAGGG - Intergenic
1087857701 11:103111519-103111541 TAGACTCACTCCAGTGGCTTAGG + Intronic
1089835124 11:121363606-121363628 TTTACTCATTACAGTGTGTTAGG + Intergenic
1091715589 12:2774123-2774145 TGCAGTCATCTCAGTGGGTTGGG - Intergenic
1093155752 12:15682914-15682936 TCTAATCATCCCAGTAGTTTTGG - Exonic
1101932738 12:109028062-109028084 AATAGCCATCCCAGTGGGTGTGG + Intronic
1103926723 12:124427386-124427408 AATAGTCATCCCAGTGCATTAGG - Intronic
1104283061 12:127396041-127396063 TGTATTCATGCCAGTGAGTTGGG - Intergenic
1105811734 13:24001635-24001657 CACACTCATCCCAGTGACTTGGG + Intronic
1107158685 13:37199306-37199328 TATATTCATGACATTGGGTTAGG - Intergenic
1108101870 13:46965541-46965563 TTTGCTCAGTCCAGTGGGTTGGG + Intergenic
1109015731 13:57010547-57010569 TATACTCATCCCAGGGGGAAGGG - Intergenic
1111043077 13:82776850-82776872 TATATTTGTCCCAGTGGGTCAGG - Intergenic
1112477009 13:99740700-99740722 TAGACTCTTCCCAGAGGCTTTGG + Intronic
1113817868 13:113187497-113187519 TACAGTCATCCCACTGGGTGTGG + Intronic
1116180844 14:41531878-41531900 TAAACCCATCCCAGTTTGTTTGG + Intergenic
1116809076 14:49522146-49522168 TATATTTATCCAACTGGGTTGGG - Intergenic
1119899089 14:78244618-78244640 TAGACACCTCCCAGAGGGTTGGG - Intronic
1120623934 14:86801330-86801352 TATAATCTTCCCAGTGCTTTTGG - Intergenic
1124017883 15:25893105-25893127 TATCCTCATCACACTGGGCTGGG - Intergenic
1129074114 15:72976762-72976784 TTTCCTGATCCCATTGGGTTTGG + Intergenic
1138303729 16:55955780-55955802 CTTTCTCATTCCAGTGGGTTTGG + Intronic
1141515546 16:84542410-84542432 AATACTCATCACAGTGGAATGGG + Intronic
1141888733 16:86911852-86911874 TGAACTCACCCCAGTGGGCTGGG - Intergenic
1144114836 17:12077963-12077985 GACACTAATCCCAGTGGATTAGG + Intronic
1145732462 17:27201203-27201225 TATATTCATCCTCGTGGGTTAGG + Intergenic
1146414398 17:32618524-32618546 TGTTCTCATCACAGTGGATTTGG + Intronic
1146763152 17:35495826-35495848 TGCCCTCATCCCAGTGGGTCTGG - Intronic
1150372945 17:64657145-64657167 TAAACGCCTACCAGTGGGTTAGG + Intronic
1152385155 17:79969439-79969461 TATAGCCATCCCAGTGGGTGTGG - Intronic
1153523086 18:5969944-5969966 CATACACATCCCAGATGGTTTGG - Intronic
1153579261 18:6555439-6555461 TATAGCCATCCTAGTGGGTGTGG + Intronic
1159474784 18:68906529-68906551 TATACTCATCCCAGTGGGTTTGG + Intronic
1159802797 18:72921645-72921667 CATGCTCAGGCCAGTGGGTTGGG + Intergenic
1164200956 19:23018183-23018205 CATAATCATCCCAGTGGGCAGGG + Intergenic
925854521 2:8116867-8116889 TATGCTCCTCCCACTGGGCTGGG + Intergenic
927833685 2:26373560-26373582 TATACTTTTCCCAGTGGGACAGG - Exonic
931331260 2:61286665-61286687 TATGCACATGCCAGTGGTTTGGG - Intronic
932161863 2:69467581-69467603 TATTCTTATCCTGGTGGGTTGGG - Intronic
934135522 2:88992784-88992806 TTTACTCAGCCCAGTGTGCTTGG - Intergenic
939870643 2:147522584-147522606 TTTACTCTTCCCAGTGTTTTTGG + Intergenic
944228775 2:197372801-197372823 TTTACTCATCCGAGGGGGGTTGG + Intergenic
947028983 2:225771060-225771082 TATGCTTGTCCCAGTGTGTTTGG + Intergenic
948077115 2:235173617-235173639 TATAGCCATCCTAGTGGGTGGGG + Intergenic
1171234872 20:23516640-23516662 TATAGTCATGCTAGTGGGTGTGG - Intergenic
1173130644 20:40389903-40389925 TATTGACATCCCAGTGGGTATGG - Intergenic
1174419897 20:50392641-50392663 CACACTCATCCCAGTGCTTTAGG + Intergenic
1178817058 21:35940959-35940981 AATACTCATCCCTTTGGGTTCGG - Intronic
1178885566 21:36482252-36482274 TAAAATCATCCCATTGAGTTAGG + Intronic
1179398751 21:41064766-41064788 TAAACACATCTCTGTGGGTTTGG - Intergenic
951302185 3:21011441-21011463 TATACTCATCACAGAGCTTTTGG + Intergenic
951367340 3:21799439-21799461 TATAGGCATCCTAGTGGGTATGG + Intronic
953830960 3:46297311-46297333 TATACTCAACCCAGGGATTTAGG - Intergenic
962741607 3:138366250-138366272 TGTCCTCATCCCCCTGGGTTGGG + Intronic
964149347 3:153505910-153505932 TATTCTCATCCCAAGGGTTTCGG + Intergenic
965830453 3:172780739-172780761 TATAACCATCCTAGTGGGTGAGG + Intronic
969169028 4:5344237-5344259 AATACTAATCAAAGTGGGTTTGG + Intronic
970581758 4:17479718-17479740 TATAGCCATCCTAGTGGGTGTGG - Intronic
973709967 4:53619896-53619918 TATAACCATCCCAGTGGGTGTGG + Intronic
974543832 4:63275081-63275103 TATACACAGCCCAGAGGGTTTGG + Intergenic
975740459 4:77424626-77424648 TATTCTCATCACACTGGGTGAGG + Intronic
978514769 4:109558514-109558536 TTCATTCCTCCCAGTGGGTTCGG - Intergenic
979017963 4:115458886-115458908 TCTACTCATCCCAGCGGGGAAGG - Intergenic
980497788 4:133607370-133607392 TATACTCATCCCAGCTGGGAGGG - Intergenic
982000029 4:151014378-151014400 TATACTCTTTTCAGTGGGTTGGG - Intronic
982412803 4:155098043-155098065 TATAAGCATCCCTGTGAGTTAGG + Intergenic
995068791 5:107893603-107893625 TATTCTGATTCCAGTGGGTTTGG + Intronic
995762282 5:115576202-115576224 TATACTATTCCCCTTGGGTTGGG - Intergenic
1000245172 5:159442992-159443014 TGTAGCCATCCCAGTGAGTTGGG - Intergenic
1003736559 6:8883927-8883949 TCTACTCACACCAGTGGGATCGG - Intergenic
1003907520 6:10715717-10715739 TATAGCCATTCCAGTGGGTGGGG + Intergenic
1006919260 6:37616667-37616689 TATTGTCATCCCAGTGGGCTGGG + Intergenic
1007323890 6:41045861-41045883 CATGCTCAGCCCAGTGGGTCAGG + Intronic
1011150782 6:84270965-84270987 TATTCTCATCTCAGTGGCTCAGG - Intergenic
1015322011 6:131887282-131887304 TATTGTCATCCCAGTGTGTTTGG + Intronic
1019303275 7:320063-320085 TATAACCATCCTAGTGGGTGTGG - Intergenic
1021588908 7:22239815-22239837 AATACTTATCCCACTGGCTTGGG + Intronic
1021725604 7:23545251-23545273 TTTTCTCATACCACTGGGTTTGG + Intergenic
1023155651 7:37249013-37249035 CATACTCCTCACACTGGGTTAGG - Intronic
1023949589 7:44832381-44832403 CAAACTGATCCCTGTGGGTTGGG + Intronic
1025251067 7:57351849-57351871 CACACTCATCCCAGTGCTTTAGG - Intergenic
1028564792 7:92217937-92217959 TATAGCCATCCTAGTGGGTGTGG + Intronic
1031630671 7:124039114-124039136 AATGCTCATCCCAGTGTGTGTGG + Intergenic
1031793821 7:126145273-126145295 TATAATATTCCCAGAGGGTTTGG + Intergenic
1033772552 7:144568501-144568523 GATATTCCTCCCAGTGGGATGGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1044558690 8:93591481-93591503 TCTACTCCAGCCAGTGGGTTTGG - Intergenic
1045380529 8:101619808-101619830 TTTACTCATCACAGTGGGAGTGG + Intronic
1046393489 8:113608575-113608597 TTTACTCATCCCAGTGTCCTTGG + Intronic
1050673898 9:8029857-8029879 TAAACTGATCCCAGTGGTTTGGG + Intergenic
1050909346 9:11047509-11047531 TATACTCATCCCCGAGGTATTGG - Intergenic
1051568866 9:18532742-18532764 TATACTCATTACAGAGGTTTTGG - Intronic
1052430069 9:28354242-28354264 GGTACTCATACCAGTAGGTTTGG + Intronic
1053064529 9:35058438-35058460 TATACTTATCCCTGATGGTTGGG - Intronic
1055951000 9:81729610-81729632 TAGAATCTTCCCAGGGGGTTAGG + Intergenic
1057023082 9:91715783-91715805 TATAGCCATCTCAGTGGGTGTGG - Intronic
1058964682 9:110025720-110025742 TATAACCATCCTAGTGGGTGTGG + Intronic
1186065145 X:5755372-5755394 TATACACATCTCAGTTGATTTGG - Intergenic
1187554886 X:20342152-20342174 TACTCTACTCCCAGTGGGTTGGG + Intergenic
1189805476 X:44731285-44731307 TATAGCCATCCAAGTGGGTGTGG - Intergenic
1192158520 X:68765268-68765290 TATAGCCATCCTAGTGGGTGTGG + Intergenic
1194345426 X:92757364-92757386 TTTATTCATCCAAGTAGGTTGGG - Intergenic
1195031948 X:100934897-100934919 TATAGTCATCCTAGTGGATTTGG + Intergenic
1195555078 X:106212311-106212333 TTTCCTTAACCCAGTGGGTTAGG - Intergenic
1196902230 X:120396282-120396304 TATAGTCATCCCACTGGGTGTGG + Intergenic
1199875074 X:151922356-151922378 TTTGCTCATCTCAGGGGGTTGGG + Intronic
1200050464 X:153427113-153427135 TATAGCCATCCCAGTGGGTGTGG + Intergenic
1201940785 Y:19457290-19457312 TATAGTCATCCTTTTGGGTTGGG - Intergenic